zgc:136380

Ensembl ID:
ENSDARG00000014366
ZFIN IDs:
ZDB-GENE-060616-375, ZDB-GENE-060616-375
Description:
cisplatin resistance-associated overexpressed protein isoform 1 [Source:RefSeq peptide;Acc:NP_00107
Human Orthologue:
LUC7L3
Human Description:
LUC7-like 3 (S. cerevisiae) [Source:HGNC Symbol;Acc:24309]
Mouse Orthologue:
Luc7l3
Mouse Description:
LUC7-like 3 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1914934]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2115 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa2115
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101253 Nonsense 40 462 2 11
ENSDART00000108869 Nonsense 40 389 2 12
Genomic Location (Zv9):
Chromosome 3 (position 59685244)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 58761639
GRCz11 3 58820946
KASP Assay ID:
554-3160.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAAGCTTTTGRTGTTTTTTTTTNTCCCAGGTCTGYAAATATTACCTGTG[C/A]GGCTTCTGTCCTGCKGAACTGTTCACAAACACGCGCTCAGACTTGGGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link