zgc:91849

Ensembl ID:
ENSDARG00000014323
ZFIN ID:
ZDB-GENE-040718-438
Description:
hypothetical protein LOC572021 [Source:RefSeq peptide;Acc:NP_001002687]
Human Orthologues:
CD101, IGSF3, IGSF8, PTGFRN
Human Descriptions:
CD101 molecule [Source:HGNC Symbol;Acc:5949]
immunoglobulin superfamily, member 3 [Source:HGNC Symbol;Acc:5950]
immunoglobulin superfamily, member 8 [Source:HGNC Symbol;Acc:17813]
prostaglandin F2 receptor negative regulator [Source:HGNC Symbol;Acc:9601]
Mouse Orthologues:
Cd101, Igsf3, Igsf8, Ptgfrn
Mouse Descriptions:
CD101 antigen Gene [Source:MGI Symbol;Acc:MGI:2685862]
immunoglobulin superfamily, member 3 Gene [Source:MGI Symbol;Acc:MGI:1926158]
immunoglobulin superfamily, member 8 Gene [Source:MGI Symbol;Acc:MGI:2154090]
prostaglandin F2 receptor negative regulator Gene [Source:MGI Symbol;Acc:MGI:1277114]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34532 Essential Splice Site Mutation detected in F1 DNA During 2018
sa7166 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34532
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002954 Essential Splice Site 23 986 None 11
ENSDART00000142964 Essential Splice Site 23 986 None 9
Genomic Location (Zv9):
Chromosome 9 (position 27710)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 456800
GRCz11 9 456433
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCTGTGGCGCTTGTTTCTGCTGTGTCTCACAGGACTCCTGCGCTGGGG[T/C]GAGTCTCAATGTTTTTATTATATCGCGAAAATATATCTGATTTTTATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7166
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002954 Essential Splice Site 285 986 3 11
ENSDART00000142964 Essential Splice Site 285 986 3 9
Genomic Location (Zv9):
Chromosome 9 (position 30779)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 453731
GRCz11 9 453364
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGCRCACAAAACCTCTACAGCATGTGATGTGGAGATCAAACCAATCGG[T/C]GAGGTTTASATTTTMTAATTTAACCCAGGGGTTNNNNNCTAACCTAACCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link