arl1

Ensembl ID:
ENSDARG00000014310
ZFIN ID:
ZDB-GENE-040718-175
Description:
ADP-ribosylation factor-like protein 1 [Source:RefSeq peptide;Acc:NP_001002473]
Human Orthologue:
ARL1
Human Description:
ADP-ribosylation factor-like 1 [Source:HGNC Symbol;Acc:692]
Mouse Orthologue:
Arl1
Mouse Description:
ADP-ribosylation factor-like 1 Gene [Source:MGI Symbol;Acc:MGI:99436]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32556 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32556
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021786 Essential Splice Site 1 181 1 6
Genomic Location (Zv9):
Chromosome Zv9_scaffold3539 (position 46878)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5904764
GRCz11 4 5913334
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATCCTTCGTCAGGAAGACAGCAGTACTAAAGTGTTAAATCTAAAATGG[G/A]TAAGTCTTCGCGAATCAAAACATATTTGGTTTAATATTATAAACAGACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link