
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
vac14
- Ensembl ID:
- ENSDARG00000014303
- ZFIN ID:
- ZDB-GENE-040912-82
- Description:
- Protein VAC14 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q66L58]
- Human Orthologue:
- VAC14
- Human Description:
- Vac14 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:25507]
- Mouse Orthologue:
- Vac14
- Mouse Description:
- Vac14 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2157980]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38043 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa8773 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa38043
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000009767 | Essential Splice Site | 198 | 771 | 5 | 19 |
The following transcripts of ENSDARG00000014303 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 25 (position 17955298)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 17499162 GRCz11 25 17595562 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAGGATTTACTCCAATAACCAATATGCTCGTCAATTCATTATCTCCTGG[G/A]TGAGTTGAGCACTTTCACCTGTCTGCAACATTCAAAGTCAGTATGGCATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8773
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000009767 | Essential Splice Site | 322 | 771 | 8 | 19 |
The following transcripts of ENSDARG00000014303 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 25 (position 17957764)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 17501628 GRCz11 25 17598028 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATATTGACAGCAGTGCTGCCTTGCCTGTCCTACGATGACCGCAAAAAGAG[T/A]ATCCTACACTGCCGTACACTCTCAATGATGCATTTMMAAGTGTTTAAGAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: