vac14

Ensembl ID:
ENSDARG00000014303
ZFIN ID:
ZDB-GENE-040912-82
Description:
Protein VAC14 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q66L58]
Human Orthologue:
VAC14
Human Description:
Vac14 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:25507]
Mouse Orthologue:
Vac14
Mouse Description:
Vac14 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2157980]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38043 Essential Splice Site Mutation detected in F1 DNA During 2018
sa8773 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38043
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009767 Essential Splice Site 198 771 5 19

The following transcripts of ENSDARG00000014303 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 17955298)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17499162
GRCz11 25 17595562
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGGATTTACTCCAATAACCAATATGCTCGTCAATTCATTATCTCCTGG[G/A]TGAGTTGAGCACTTTCACCTGTCTGCAACATTCAAAGTCAGTATGGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8773
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009767 Essential Splice Site 322 771 8 19

The following transcripts of ENSDARG00000014303 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 17957764)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17501628
GRCz11 25 17598028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATTGACAGCAGTGCTGCCTTGCCTGTCCTACGATGACCGCAAAAAGAG[T/A]ATCCTACACTGCCGTACACTCTCAATGATGCATTTMMAAGTGTTTAAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link