JAG2 (2 of 2)
- Ensembl ID:
- ENSDARG00000014246
- Description:
- jagged 2 [Source:HGNC Symbol;Acc:6189]
- Human Orthologue:
- JAG2
- Human Description:
- jagged 2 [Source:HGNC Symbol;Acc:6189]
- Mouse Orthologue:
- Jag2
- Mouse Description:
- jagged 2 Gene [Source:MGI Symbol;Acc:MGI:1098270]
Alleles
There are 9 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa35540 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa22342 |
Essential Splice Site |
Available for shipment |
Available now |
sa11543 |
Essential Splice Site |
Available for shipment |
Available now |
sa6320 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa10076 |
Nonsense |
Available for shipment |
Available now |
sa28157 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa35541 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa35542 |
Nonsense |
Available for shipment |
Available now |
sa13426 |
Essential Splice Site |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa35540
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000025007 |
Nonsense |
67 |
1136 |
1 |
29 |
- Genomic Location (Zv9):
- Chromosome 13 (position 33713239)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
33379219 |
GRCz11 |
13 |
33488764 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGAATACCAGGTGGAGGTCACCACATCTGGCTTTTGTACGTACGGCACT[G/T]GAAGCTCGAGCGTGGTCGGGGGGAATACGTTTCAGTTGAAAGGATTCAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22342
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000025007 |
Essential Splice Site |
232 |
1136 |
6 |
29 |
- Genomic Location (Zv9):
- Chromosome 13 (position 33745537)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
33411517 |
GRCz11 |
13 |
33521062 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATGAGTCTGTTCGTTAGAGTAAAATTGTTCCACACACACATCACACACA[T/G]TTGACGGCATGCATGTCAGCTTTAAATAGTAGTGAATGAGCTGAGCAAAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11543
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000025007 |
Essential Splice Site |
273 |
1136 |
7 |
29 |
- Genomic Location (Zv9):
- Chromosome 13 (position 33746802)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
33412782 |
GRCz11 |
13 |
33522327 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CTGGACGTGCACCTRTGAGAAAAATTGGGGTGGACTTCTGTGTGACAAAG[G/A]TARGTGATACTTTTAAGTAACYACAGATGCAATTAACTGRATAAATRAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6320
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000025007 |
Nonsense |
301 |
1136 |
8 |
29 |
- Genomic Location (Zv9):
- Chromosome 13 (position 33748865)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
33414845 |
GRCz11 |
13 |
33524390 |
- KASP Assay ID:
- 554-5422.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TGTAAATGGAGGCACGTGTTTGAATACAGAGCCGGATGAATATTTCTGCT[T/A]GTGCCCTGAGGGMTATTCTGGTGAAAACTGCCATATCTGTAAGAAAGCTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10076
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000025007 |
Nonsense |
538 |
1136 |
15 |
29 |
- Genomic Location (Zv9):
- Chromosome 13 (position 33757995)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
33423975 |
GRCz11 |
13 |
33533520 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TTTACTGYGCCTGTGCTGATGAATRCGAGGGGAAGACATGCAGTCAGCTA[C/T]GAGACCACTGCAAGACCAGCACGTGCCATGGTAGACTACTTCCTATATAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa28157
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000025007 |
Nonsense |
742 |
1136 |
20 |
29 |
- Genomic Location (Zv9):
- Chromosome 13 (position 33762112)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
33428092 |
GRCz11 |
13 |
33537637 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGGCCCGTGTCTAAATGGGGGCACTTGCATAGGCTCGGGCAGCGTCTTC[A/T]AGTGCATCTGTAAGGATGGATGGGAGGGGCCTACTTGTGCTCAGAGTAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35541
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000025007 |
Nonsense |
745 |
1136 |
20 |
29 |
- Genomic Location (Zv9):
- Chromosome 13 (position 33762123)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
33428103 |
GRCz11 |
13 |
33537648 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTAAATGGGGGCACTTGCATAGGCTCGGGCAGCGTCTTCAAGTGCATCTG[T/A]AAGGATGGATGGGAGGGGCCTACTTGTGCTCAGAGTAAGATCACGCCCAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35542
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000025007 |
Nonsense |
821 |
1136 |
23 |
29 |
- Genomic Location (Zv9):
- Chromosome 13 (position 33764387)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
33430367 |
GRCz11 |
13 |
33539912 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTTATGGAGCCACATGTGTAGATGAGATTAATGGATATCGCTGTCTGTG[C/A]CCCATGGGACGAGCTGGACCACGCTGCCAGGACTGTGAGTTCCCACTGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13426
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000025007 |
Essential Splice Site |
956 |
1136 |
25 |
29 |
- Genomic Location (Zv9):
- Chromosome 13 (position 33767490)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
33433470 |
GRCz11 |
13 |
33543015 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TCAACTGTGCTCKTGTTACACTTGTATTTGACTCWGACACTGTACCGCAG[G/A]TAAGAGGTTTTCATTTAATTTGTTTTATGCATTTAAAAGAGGTGAAGCTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: