
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
esyt1b
- Ensembl ID:
- ENSDARG00000014239
- ZFIN ID:
- ZDB-GENE-040724-209
- Description:
- Novel protein similar to mouse and human membrane bound C2 domain containing protein (MBC2) [Source:
- Human Orthologue:
- ESYT1
- Human Description:
- extended synaptotagmin-like protein 1 [Source:HGNC Symbol;Acc:29534]
- Mouse Orthologue:
- Esyt1
- Mouse Description:
- extended synaptotagmin-like protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344426]
Alleles
There are 7 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa13012 | Nonsense | Available for shipment | Available now |
sa10630 | Nonsense | Available for shipment | Available now |
sa20822 | Nonsense | Available for shipment | Available now |
sa40794 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa30880 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa26837 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa1525 | Essential Splice Site | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa13012
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014819 | Nonsense | 317 | 1032 | 9 | 35 |
ENSDART00000140223 | None | 314 | None | 10 | |
ENSDART00000144174 | Nonsense | 352 | 1076 | 9 | 31 |
- Genomic Location (Zv9):
- Chromosome 6 (position 52235795)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 52284977 GRCz11 6 52284976 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTGTGATGGCCGGCATGTCTGACCCGTACGCCATTGTCCGAGTCGGACCA[C/T]AAACCTTSAAATCCCATCACCTGGACAACACKCTCAGTCCCAAATGGGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10630
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014819 | Nonsense | 746 | 1032 | 23 | 35 |
ENSDART00000140223 | None | 314 | None | 10 | |
ENSDART00000144174 | Nonsense | 705 | 1076 | 20 | 31 |
- Genomic Location (Zv9):
- Chromosome 6 (position 52263496)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 52312678 GRCz11 6 52312677 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGGCAGTGCCGTCTGCAGCTCTCCTGTTTKTGTATGTGGAGCAAGCATAT[G/T]AGCTTCCTGTGAGTATTAACACTAATGTTAGCTCTTTAAWTAGCTCATTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20822
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014819 | None | 1032 | None | 35 | |
ENSDART00000140223 | None | 314 | None | 10 | |
ENSDART00000144174 | Nonsense | 840 | 1076 | 24 | 31 |
- Genomic Location (Zv9):
- Chromosome 6 (position 52269026)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 52318208 GRCz11 6 52318207 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCGAAGGATGGTCTGATGGGTGGGATGGTGAAGGGGAAAAGTGACCCGTA[T/A]GTTAAGATCCACATCGGTGACACAACATTTAAGAGTCACGTAATCAAGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40794
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014819 | Nonsense | 823 | 1032 | 26 | 35 |
ENSDART00000140223 | None | 314 | None | 10 | |
ENSDART00000144174 | Nonsense | 1049 | 1076 | 31 | 31 |
ENSDART00000014819 | Nonsense | 823 | 1032 | 26 | 35 |
ENSDART00000140223 | None | 314 | None | 10 | |
ENSDART00000144174 | Nonsense | 1049 | 1076 | 31 | 31 |
- Genomic Location (Zv9):
- Chromosome 6 (position 52272815)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 52321997 GRCz11 6 52321996 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCGAGCAGCCGCTGGGCTCTCTGGTTCTGCCAATCAGAGAGCTGCTTTCT[A/T]AAACAGACCTGCTGATGGACCAATGGCTGAGTCTGGATGGAGCAGCTGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30880
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014819 | Nonsense | 823 | 1032 | 26 | 35 |
ENSDART00000140223 | None | 314 | None | 10 | |
ENSDART00000144174 | Nonsense | 1049 | 1076 | 31 | 31 |
ENSDART00000014819 | Nonsense | 823 | 1032 | 26 | 35 |
ENSDART00000140223 | None | 314 | None | 10 | |
ENSDART00000144174 | Nonsense | 1049 | 1076 | 31 | 31 |
- Genomic Location (Zv9):
- Chromosome 6 (position 52272815)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 52321997 GRCz11 6 52321996 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCGAGCAGCCGCTGGGCTCTCTGGTTCTGCCAATCAGAGAGCTGCTTTCT[A/T]AAACAGACCTGCTGATGGACCAATGGCTGAGTCTGGATGGAGCAGCTGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa26837
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014819 | Nonsense | 842 | 1032 | 26 | 35 |
ENSDART00000140223 | None | 314 | None | 10 | |
ENSDART00000144174 | Nonsense | 1068 | 1076 | 31 | 31 |
- Genomic Location (Zv9):
- Chromosome 6 (position 52272872)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 52322054 GRCz11 6 52322053 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACCTGCTGATGGACCAATGGCTGAGTCTGGATGGAGCAGCTGCTGACAGT[C/T]AGATTCTTCTCAGAGCTCAACTCAAGGTCAGACTGAGCTTTTTCTGATCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1525
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014819 | Essential Splice Site | 934 | 1032 | 32 | 35 |
ENSDART00000140223 | Essential Splice Site | 217 | 314 | 7 | 10 |
ENSDART00000144174 | None | 1076 | None | 31 |
- Genomic Location (Zv9):
- Chromosome 6 (position 52284657)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 52333839 GRCz11 6 52333838 - KASP Assay ID:
- 554-1449.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCTCCATGTCCTTCCAGAAGAAGCTGACGCTGCTCGTCCACAACTGCAGG[T/A]CTGAGCTACACTCATGACGAGTTNNTGAGTTATCTCTGTNNGTGTGAAGTTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Systemic sclerosis: Identification of novel genetic markers associated with clinical phenotypes of systemic sclerosis through a genome-wide association strategy. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: