zgc:86598

Ensembl ID:
ENSDARG00000014222
ZFIN ID:
ZDB-GENE-040625-181
Description:
casein kinase II alpha 1 subunit [Source:RefSeq peptide;Acc:NP_001002164]
Human Orthologue:
CSNK2A1
Human Description:
casein kinase 2, alpha 1 polypeptide [Source:HGNC Symbol;Acc:2457]
Mouse Orthologue:
Csnk2a1
Mouse Description:
casein kinase 2, alpha 1 polypeptide Gene [Source:MGI Symbol;Acc:MGI:88543]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11456 Essential Splice Site Available for shipment Available now
sa7459 Missense Mutation detected in F1 DNA During 2018
sa36759 Nonsense Mutation detected in F1 DNA During 2018
sa32228 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11456
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020344 Essential Splice Site 122 393 6 14
ENSDART00000125504   None 105 None 6
Genomic Location (Zv9):
Chromosome 19 (position 3784655)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3281228
GRCz11 19 3222126
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGAACTCCGGCTCTGGTTTTTGAAMATGTGAACAACACAGACTTCAAGG[T/C]AAAKCACTTTAAATCTACCTCAGCTTATTGCATGATGAAATWAARCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7459
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020344 Missense 164 393 8 14
ENSDART00000125504   None 105 None 6
Genomic Location (Zv9):
Chromosome 19 (position 3787818)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3284391
GRCz11 19 3225289
KASP Assay ID:
554-4133.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACAGTATGGGGATCATGCACAGAGACGTGAAGCCACACAACGTCATGA[T/A]CGACCATGAACACAGAAAGGTACTGTTCTCCTGCAGTTCACGCCATTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36759
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020344 Nonsense 307 393 12 14
ENSDART00000125504   None 105 None 6
Genomic Location (Zv9):
Chromosome 19 (position 3792915)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3289488
GRCz11 19 3230386
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTGGTGAGCACTGAAGCTCTGGACTTCCTGGATAAACTCCTGCGCTA[C/A]GACCACCAGGCCCGACTGACTGCCCGCGAGGCCATGGAGCACCCTTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32228
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020344 Nonsense 392 393 14 14
ENSDART00000125504   None 105 None 6
Genomic Location (Zv9):
Chromosome 19 (position 3794947)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3291520
GRCz11 19 3232418
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCGTCTCCCAGTGCTCTCGCCACACAGGTTCCTGCCGCCGCCGGAGCG[C/T]AGCCCTGAACCTCCGTCTCTCTGCCCTGGCCCACAGTACACTAACCAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link