zgc:110183

Ensembl ID:
ENSDARG00000014209
ZFIN ID:
ZDB-GENE-050417-380
Description:
outer dense fiber of sperm tails 3-like 2 [Source:RefSeq peptide;Acc:NP_001017836]
Human Orthologue:
ODF3L2
Human Description:
outer dense fiber of sperm tails 3-like 2 [Source:HGNC Symbol;Acc:26841]
Mouse Orthologue:
Odf3l2
Mouse Description:
outer dense fiber of sperm tails 3-like 2 Gene [Source:MGI Symbol;Acc:MGI:2686003]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10819 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10819
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023208 Nonsense 82 254 3 4
Genomic Location (Zv9):
Chromosome 2 (position 42031946)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42081410
GRCz11 2 41930828
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATCGYGTGGATGCCAAAATGACGCGCTTTGGCAGAGACGGGACCCCGT[C/A]GTACTCCATGCTGGGTAGAAGGAAGAGAACAGGTCAGTTTTCGTCTGATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link