axin2

Ensembl ID:
ENSDARG00000014147
ZFIN ID:
ZDB-GENE-000403-2
Description:
Axin-2 [Source:UniProtKB/Swiss-Prot;Acc:P57095]
Human Orthologue:
AXIN2
Human Description:
axin 2 [Source:HGNC Symbol;Acc:904]
Mouse Orthologue:
Axin2
Mouse Description:
axin2 Gene [Source:MGI Symbol;Acc:MGI:1270862]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40180 Nonsense Mutation detected in F1 DNA During 2018
sa40181 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45159 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40180
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019803   None 268 None 3
ENSDART00000020575 Nonsense 456 812 6 11
ENSDART00000124707   None 321 None 3

The following transcripts of ENSDARG00000014147 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 56627761)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 55388462
GRCz11 3 55640071
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTTTCCAGAGTCCTCAAGACCCCTGGCTGTCAGTCTCCAGGATTGCTT[C/T]GACATTCCCCACGCTCTCGCTCTCCTGAACAGCGTCCCCTGCCTCGGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40181
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019803   None 268 None 3
ENSDART00000020575 Essential Splice Site 561 812 7 11
ENSDART00000124707   None 321 None 3

The following transcripts of ENSDARG00000014147 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 56628176)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 55388047
GRCz11 3 55639656
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAGATAATAAAATTTTTGTTTTACTGATTTAATTTTTTTTTTTACTACT[A/T]GGCATTCCAGTACTTTATCCAAGCGTCTGTGTAAATCTGGAGAGGAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45159
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019803   None 268 None 3
ENSDART00000020575 Essential Splice Site 771 812 10 11
ENSDART00000124707   None 321 None 3

The following transcripts of ENSDARG00000014147 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 56632509)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 55383714
GRCz11 3 55635323
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTACCCTCGGACACTTCAAGGAACAACTACGGAAAAAAGGCAACTACAG[G/A]TATACTTTTAATTCTGACAACTTATTTATTAGTTCATTTATTTGTTCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link