wdr82

Ensembl ID:
ENSDARG00000014083
ZFIN ID:
ZDB-GENE-030131-333
Description:
WD repeat-containing protein 82 [Source:UniProtKB/Swiss-Prot;Acc:Q6NV31]
Human Orthologue:
WDR82
Human Description:
WD repeat domain 82 [Source:HGNC Symbol;Acc:28826]
Mouse Orthologue:
Wdr82
Mouse Description:
WD repeat domain containing 82 Gene [Source:MGI Symbol;Acc:MGI:1924555]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1817 Missense Confirmed mutation in F2 line During 2018
sa33933 Essential Splice Site Mutation detected in F1 DNA During 2018
sa26804 Splice Site, Nonsense Mutation detected in F1 DNA During 2018
sa16143 Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1817
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007353 Missense 131 313 4 9
ENSDART00000007798 Missense 131 600 4 16
Genomic Location (Zv9):
Chromosome 6 (position 41386067)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41457667
GRCz11 6 41455203
KASP Assay ID:
554-1809.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGTCCCCTGTTGATGACACATTCATTTCTGGCTCCCTTGACAAAACCA[T/A]TCGTCTGTGGGACCTTCGCTCGCCTAACTGTCAAGTAAGCTGTTTTTTAA
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control on top; Mutant below; 72 hpf

Control on top; Mutant below; 72 hpf

zoom

Stage Entity Quality Tag
Larval:Protruding-mouth
ZFS:0000035
brain
ZFA:0000008
hydrocephalic
PATO:0001853
abnormal
PATO:0000460
Larval:Protruding-mouth
ZFS:0000035
head
ZFA:0001114
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Protruding-mouth
ZFS:0000035
inner ear
ZFA:0000217
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Protruding-mouth
ZFS:0000035
melanocyte
ZFA:0009091
quality
PATO:0000001
abnormal
PATO:0000460
Larval:Protruding-mouth
ZFS:0000035
pericardium
ZFA:0000054
edematous
PATO:0001450
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa33933
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007353 Essential Splice Site 257 313 7 9
ENSDART00000007798 Essential Splice Site 257 600 7 16
Genomic Location (Zv9):
Chromosome 6 (position 41389577)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41461177
GRCz11 6 41458713
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCATTTTGGAGGCTTCTTTCACACCAGACTCTCAGTTCATTATGATCGG[T/G]AAGTCTTCACTTAAGCTTCTCACAGGACTACAAAAGGACTTAAGATGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26804
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007353   None 313 None 9
ENSDART00000007798 Splice Site, Nonsense 394 600 10 16

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 41416990)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41488590
GRCz11 6 41486126
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAAGAGTTTGGTGGTGGACACGTCAAAGATGAGATGTTTGGCACAGTT[G/T]AGGTAAGCAGAATGAGTTTCATTTCATTCATTCATTCATTCATTCATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16143
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007353   None 313 None 9
ENSDART00000007798 Splice Site None 600 None 16

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 41424272)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41495872
GRCz11 6 41493408
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGTGTGGACCCCAAACATCAGACTCTACAGGGTCTTGCTTTTCCMTTA[C/T]AGGCTGAAGCCAAACGTGCTTTAAAGCASCTCGCAGAGAGACGCATCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link