Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
wdr82
- Ensembl ID:
- ENSDARG00000014083
- ZFIN ID:
- ZDB-GENE-030131-333
- Description:
- WD repeat-containing protein 82 [Source:UniProtKB/Swiss-Prot;Acc:Q6NV31]
- Human Orthologue:
- WDR82
- Human Description:
- WD repeat domain 82 [Source:HGNC Symbol;Acc:28826]
- Mouse Orthologue:
- Wdr82
- Mouse Description:
- WD repeat domain containing 82 Gene [Source:MGI Symbol;Acc:MGI:1924555]
Alleles
There are 4 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa1817 | Missense | Confirmed mutation in F2 line | During 2018 |
| sa33933 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa26804 | Splice Site, Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa16143 | Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa1817
- Current Status:
-
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Missense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000007353 | Missense | 131 | 313 | 4 | 9 |
| ENSDART00000007798 | Missense | 131 | 600 | 4 | 16 |
- Genomic Location (Zv9):
- Chromosome 6 (position 41386067)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 41457667 GRCz11 6 41455203 - KASP Assay ID:
- 554-1809.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TATGTCCCCTGTTGATGACACATTCATTTCTGGCTCCCTTGACAAAACCA[T/A]TCGTCTGTGGGACCTTCGCTCGCCTAACTGTCAAGTAAGCTGTTTTTTAA
- Associated Phenotype:
-
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.
Stage Entity Quality Tag Larval:Protruding-mouth
ZFS:0000035brain
ZFA:0000008hydrocephalic
PATO:0001853abnormal
PATO:0000460Larval:Protruding-mouth
ZFS:0000035head
ZFA:0001114decreased size
PATO:0000587abnormal
PATO:0000460Larval:Protruding-mouth
ZFS:0000035inner ear
ZFA:0000217decreased size
PATO:0000587abnormal
PATO:0000460Larval:Protruding-mouth
ZFS:0000035melanocyte
ZFA:0009091quality
PATO:0000001abnormal
PATO:0000460Larval:Protruding-mouth
ZFS:0000035pericardium
ZFA:0000054edematous
PATO:0001450abnormal
PATO:0000460
Mutation Details
- Allele Name:
- sa33933
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000007353 | Essential Splice Site | 257 | 313 | 7 | 9 |
| ENSDART00000007798 | Essential Splice Site | 257 | 600 | 7 | 16 |
- Genomic Location (Zv9):
- Chromosome 6 (position 41389577)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 41461177 GRCz11 6 41458713 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTCATTTTGGAGGCTTCTTTCACACCAGACTCTCAGTTCATTATGATCGG[T/G]AAGTCTTCACTTAAGCTTCTCACAGGACTACAAAAGGACTTAAGATGAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa26804
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Splice Site, Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000007353 | None | 313 | None | 9 | |
| ENSDART00000007798 | Splice Site, Nonsense | 394 | 600 | 10 | 16 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 6 (position 41416990)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 41488590 GRCz11 6 41486126 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAAAGAGTTTGGTGGTGGACACGTCAAAGATGAGATGTTTGGCACAGTT[G/T]AGGTAAGCAGAATGAGTTTCATTTCATTCATTCATTCATTCATTCATTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16143
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000007353 | None | 313 | None | 9 | |
| ENSDART00000007798 | Splice Site | None | 600 | None | 16 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 6 (position 41424272)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 41495872 GRCz11 6 41493408 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCAGTGTGGACCCCAAACATCAGACTCTACAGGGTCTTGCTTTTCCMTTA[C/T]AGGCTGAAGCCAAACGTGCTTTAAAGCASCTCGCAGAGAGACGCATCAAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
