zgc:113183

Ensembl ID:
ENSDARG00000014041
ZFIN ID:
ZDB-GENE-050522-499
Description:
SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing D
Human Orthologue:
SMARCAD1
Human Description:
SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing D
Mouse Orthologue:
Smarcad1
Mouse Description:
SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing D

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38698 Essential Splice Site Mutation detected in F1 DNA During 2018
sa1299 Essential Splice Site, Missense Available for shipment Available now
sa18922 Nonsense Mutation detected in F1 DNA During 2018
sa12057 Nonsense Available for shipment Available now
sa11941 Nonsense Available for shipment Available now
sa41231 Nonsense Mutation detected in F1 DNA During 2018
sa16448 Nonsense Available for shipment Available now
sa18923 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38698
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091409 Essential Splice Site 104 972 3 23
ENSDART00000133047 Essential Splice Site 38 154 3 8
ENSDART00000139029 Essential Splice Site 104 385 3 8

The following transcripts of ENSDARG00000014041 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 30485081)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29627807
GRCz11 8 29637039
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGCTGTTAGAGATATTCCCACAGAAGAGCAAGAAAGATCTACTAGAGG[T/C]AATGAGAATGTCAAGAAATGGAGGTTCTTGAAAAATTAGGTGAACGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1299
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091409 Essential Splice Site 379 972 8 23
ENSDART00000133047   None 154 None 8
ENSDART00000139029 Missense 380 385 8 8

The following transcripts of ENSDARG00000014041 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 30489020)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29631746
GRCz11 8 29640978
KASP Assay ID:
554-1214.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCCAGAAGATCATTTCACTGAGGCCTTTCAACACTTGGAAAGATGTGG[T/G]AAGGATCTGCTGTCTGTAACTTTYTTGTTAATCTTTACTGGCARTTATTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa18922
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091409 Nonsense 575 972 14 23
ENSDART00000133047   None 154 None 8
ENSDART00000139029   None 385 None 8
ENSDART00000091409 Nonsense 575 972 14 23
ENSDART00000133047   None 154 None 8
ENSDART00000139029   None 385 None 8
ENSDART00000091409 Nonsense 575 972 14 23
ENSDART00000133047   None 154 None 8
ENSDART00000139029   None 385 None 8

The following transcripts of ENSDARG00000014041 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 30491966)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29634692
GRCz11 8 29643924
KASP Assay ID:
2260-0748.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGGAAATGACCATGATCGCAGTCTCTTCCGCAAGCTGAAGCTGAAATA[T/A]GCAGTGTTTGATGAGGGCCACATGCTTAAAAACATGAACTCGCTACGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12057
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091409 Nonsense 575 972 14 23
ENSDART00000133047   None 154 None 8
ENSDART00000139029   None 385 None 8
ENSDART00000091409 Nonsense 575 972 14 23
ENSDART00000133047   None 154 None 8
ENSDART00000139029   None 385 None 8
ENSDART00000091409 Nonsense 575 972 14 23
ENSDART00000133047   None 154 None 8
ENSDART00000139029   None 385 None 8

The following transcripts of ENSDARG00000014041 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 30491966)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29634692
GRCz11 8 29643924
KASP Assay ID:
2260-0748.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAGGAAATGACCATGATCGCAGTCTCTTCCGCAAGCTGAAGCTGAAATA[T/A]GCAGTGTTTGATGAGGGCCACATGCTTAAAAACATGAACTCKCTACGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11941
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091409 Nonsense 575 972 14 23
ENSDART00000133047   None 154 None 8
ENSDART00000139029   None 385 None 8
ENSDART00000091409 Nonsense 575 972 14 23
ENSDART00000133047   None 154 None 8
ENSDART00000139029   None 385 None 8
ENSDART00000091409 Nonsense 575 972 14 23
ENSDART00000133047   None 154 None 8
ENSDART00000139029   None 385 None 8

The following transcripts of ENSDARG00000014041 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 30491966)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29634692
GRCz11 8 29643924
KASP Assay ID:
2260-0748.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAGGAAATGACCATGATCGCAGTCTCTTCCGCAAGCTGAAGCTGAAATA[T/A]GCAGTGTTTGATGAGGGCCACATGCTTAAAAACATGAACTCKCTACGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41231
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091409 Nonsense 661 972 16 23
ENSDART00000133047   None 154 None 8
ENSDART00000139029   None 385 None 8

The following transcripts of ENSDARG00000014041 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 30492526)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29635252
GRCz11 8 29644484
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCCTCAGAAGAGGAAAGCAGTTTTCACAAGGACAGAATCGCTCAGGCC[A/T]GACTTATCATGAAGCCATTTATCTTGAGACGAGTCAAGAGTGAGGTAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16448
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091409 Nonsense 671 972 16 23
ENSDART00000133047   None 154 None 8
ENSDART00000139029   None 385 None 8
ENSDART00000091409 Nonsense 671 972 16 23
ENSDART00000133047   None 154 None 8
ENSDART00000139029   None 385 None 8

The following transcripts of ENSDARG00000014041 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 30492556)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29635282
GRCz11 8 29644514
KASP Assay ID:
2260-0749.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGACAGAATCGCTCAGGCCAGACTTATCATGAAGCCATTTATCTTGAGA[C/T]GAGTCAAGAGTGAGGTAGACAKTTTTAAAAAAAAAATGTNNNNNNATTAATATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18923
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091409 Nonsense 671 972 16 23
ENSDART00000133047   None 154 None 8
ENSDART00000139029   None 385 None 8
ENSDART00000091409 Nonsense 671 972 16 23
ENSDART00000133047   None 154 None 8
ENSDART00000139029   None 385 None 8

The following transcripts of ENSDARG00000014041 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 30492556)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29635282
GRCz11 8 29644514
KASP Assay ID:
2260-0749.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACAGAATCGCTCAGGCCAGACTTATCATGAAGCCATTTATCTTGAGA[C/T]GAGTCAAGAGTGAGGTAGACAGTTTTAAAAAAAAAATGTATTAATATTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link