zgc:77086

Ensembl ID:
ENSDARG00000014015
ZFIN ID:
ZDB-GENE-040426-2238
Description:
hypothetical protein LOC405841 [Source:RefSeq peptide;Acc:NP_998070]
Human Orthologue:
PDIA3
Human Description:
protein disulfide isomerase family A, member 3 [Source:HGNC Symbol;Acc:4606]
Mouse Orthologue:
Pdia3
Mouse Description:
protein disulfide isomerase associated 3 Gene [Source:MGI Symbol;Acc:MGI:95834]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13476 Essential Splice Site Available for shipment Available now
sa32098 Nonsense Available for shipment Available now
sa36171 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa13476
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018504 Essential Splice Site 48 488 1 13
Genomic Location (Zv9):
Chromosome 16 (position 32737590)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30476105
GRCz11 16 30434032
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCGCAGGCATGCATGACACWCTGCTAGTGGAGTTCTTCGCACCTTGG[T/C]TTGTCCAAGATCTAGTCATAATTGTATAAAATTAGAATTTCGTGWGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32098
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018504 Nonsense 52 488 2 13
Genomic Location (Zv9):
Chromosome 16 (position 32736064)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30474579
GRCz11 16 30432506
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTATCATTTACATCCCTCATCTGATGTTACCACAGGTGTGGTCATTG[T/A]CAACGACTCGCTCCAGAATATGAAGCTGCTGCCACTAAGTTGAAAGGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36171
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018504 Nonsense 235 488 7 13
Genomic Location (Zv9):
Chromosome 16 (position 32730087)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30468602
GRCz11 16 30426529
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTCTTGATTTTATACTCTTCTTGATATGCTTTTAGACTTGGTCTCTG[T/A]CCACATATGACCATGGAAAACCGGGACACAGTAAGAGAAAGTGACCTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link