zgc:153452

Ensembl ID:
ENSDARG00000014008
ZFIN ID:
ZDB-GENE-060929-452
Description:
Pre-mRNA-splicing factor CWC22 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q08C72]
Human Orthologue:
CWC22
Human Description:
CWC22 spliceosome-associated protein homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:29322]
Mouse Orthologues:
Cwc22, Gm13691, Gm13693, Gm13694, Gm13695, Gm13696, Gm13697, Gm13698
Mouse Descriptions:
CWC22 spliceosome-associated protein homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2136773
predicted gene 13691 Gene [Source:MGI Symbol;Acc:MGI:3702053]
predicted gene 13693 Gene [Source:MGI Symbol;Acc:MGI:3702055]
predicted gene 13694 Gene [Source:MGI Symbol;Acc:MGI:3702064]
predicted gene 13695 Gene [Source:MGI Symbol;Acc:MGI:3702066]
predicted gene 13696 Gene [Source:MGI Symbol;Acc:MGI:3702068]
predicted gene 13697 Gene [Source:MGI Symbol;Acc:MGI:3702070]
predicted gene 13698 Gene [Source:MGI Symbol;Acc:MGI:3702072]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17462 Nonsense Available for shipment Available now
sa34751 Essential Splice Site Mutation detected in F1 DNA During 2018
sa5566 Nonsense F2 line generated During 2018
sa15694 Nonsense Available for shipment Available now
sa45377 Nonsense Mutation detected in F1 DNA During 2018
sa21586 Essential Splice Site Available for shipment Available now
sa14487 Nonsense Available for shipment Available now
sa34750 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa17462
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023684 Nonsense 339 983 8 21

The following transcripts of ENSDARG00000014008 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 44693482)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43818652
GRCz11 9 43620439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGGAGAACTTATCCTCAAGAGGCTTAWCCTTAATTTCCGGAAAGGTTA[C/A]AGGAGGAATGAKAAAGTAAGCCCTCAGGAAACACTGGGTACAGGTTTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34751
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023684 Essential Splice Site 344 983 8 21

The following transcripts of ENSDARG00000014008 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 44693465)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43818635
GRCz11 9 43620422
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGAGGCTTATCCTTAATTTCCGGAAAGGTTACAGGAGGAATGATAAAG[T/A]AAGCCCTCAGGAAACACTGGGTACAGGTTTCTAAATGGAGCACTGGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5566
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023684 Nonsense 419 983 11 21

The following transcripts of ENSDARG00000014008 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 44691091)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43816261
GRCz11 9 43618048
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTGTCATTTTTTCCAGCCATCTTTGAACGTCTGAGGAACATCTTGCAT[G/T]AGTCAGAGATAGATAAGCGTGTACAGTACATGATTGAGGTGATGTTTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15694
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023684 Nonsense 450 983 11 21

The following transcripts of ENSDARG00000014008 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 44690998)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43816168
GRCz11 9 43617955
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTGCCATCAGGAAGGATGGGTTTAARGACCATCCCATCATYCCAGAA[G/T]GACTTGACCTAGTGGAGGAAGAGGACCARTTCACACACATGCTTCCTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45377
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023684 Nonsense 680 983 18 21

The following transcripts of ENSDARG00000014008 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 44632951)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43758121
GRCz11 9 43559908
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGAGCGAAGACACAACAACATCCTCCAGTCGAATCTTTGTGAAGATTT[T/A]GTTCCAGGAACTTTGTGCTTACATGGGTTTGCCAAAACTAAATGAGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21586
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023684 Essential Splice Site 734 983 19 21

The following transcripts of ENSDARG00000014008 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 44632695)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43757865
GRCz11 9 43559652
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGATTCGCCATTAATTTCTTCACATCTATCGGCCTTGGAGGACTAAC[G/A]TAAGTGTCTGTGATTACTCTCTATTTGGGTCTGCTTTGTTTATTATGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14487
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023684 Nonsense 836 983 21 21

The following transcripts of ENSDARG00000014008 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 44626316)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43751486
GRCz11 9 43553273
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGCAAGANNNNNNAATCCAGCAAGGCAGCAAACCAGCGATCTCCCTTAGAGGAA[C/T]GACCCASCAAGAGACACGAGAACCGCCGTCAGGACGCCAGCAAAGAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34750
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023684 Nonsense 876 983 21 21

The following transcripts of ENSDARG00000014008 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 44626196)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43751366
GRCz11 9 43553153
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACAGAGATCCTCAGCGGCGCGGACAACAGGACGAGTCACCTCCTGCT[C/T]GACCGAGAGGAGAACCAGAGCGCATAAGAGGACAGAAAGAACCTCACAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link