
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
eif2b4
- Ensembl ID:
- ENSDARG00000014004
- ZFIN ID:
- ZDB-GENE-030131-955
- Description:
- translation initiation factor eIF-2B subunit delta [Source:RefSeq peptide;Acc:NP_001014383]
- Human Orthologue:
- EIF2B4
- Human Description:
- eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa [Source:HGNC Symbol;Acc:3260]
- Mouse Orthologue:
- Eif2b4
- Mouse Description:
- eukaryotic translation initiation factor 2B, subunit 4 delta Gene [Source:MGI Symbol;Acc:MGI:95300]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa17367 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa17367
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026239 | Essential Splice Site | 475 | 541 | 12 | 13 |
ENSDART00000125830 | Essential Splice Site | 474 | 540 | 12 | 13 |
- Genomic Location (Zv9):
- Chromosome 20 (position 19590687)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 19618944 GRCz11 20 19518527 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAAGTTCTGTGAACGAGTGCAGACGGACTCTTTTGTATCCAATGAATTAG[G/A]TAACTGTCATGTTGTGCTTACTTAATAAAATTTGCATCATTTTATTTTAT
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: