si:ch211-124k10.2

Ensembl ID:
ENSDARG00000014003
ZFIN ID:
ZDB-GENE-030131-9447
Description:
StAR-related lipid transfer domain containing 8 [Source:RefSeq peptide;Acc:NP_001119949]
Human Orthologue:
STARD8
Human Description:
StAR-related lipid transfer (START) domain containing 8 [Source:HGNC Symbol;Acc:19161]
Mouse Orthologue:
Stard8
Mouse Description:
START domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:2448556]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1039 Essential Splice Site F2 line generated During 2018
sa45212 Nonsense Mutation detected in F1 DNA During 2018
sa940 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa1039
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022043 Essential Splice Site 39 614 1 9
ENSDART00000051333 Essential Splice Site 39 1076 1 14
ENSDART00000127383 Essential Splice Site 39 1076 1 14
Genomic Location (Zv9):
Chromosome 5 (position 37404493)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35186442
GRCz11 5 35786595
KASP Assay ID:
554-0942.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGCCCTGACTTTACTGCGGAGGAAGGCGAAACAGCGGCAGTTTGCGGG[T/A]AAGTWATGCCACTGTTTGGAGGAGGCTGTGAGATTTTCTTAAGAAACTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45212
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022043 Nonsense 48 614 2 9
ENSDART00000051333 Nonsense 48 1076 2 14
ENSDART00000127383 Nonsense 48 1076 2 14
Genomic Location (Zv9):
Chromosome 5 (position 37439224)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35221173
GRCz11 5 35821326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTCATGTTTCTCTCTTCCAGAGCTGGAGGCAAAAGACGCCTGTGAGTG[G/A]CTCCGAGCGGCGGGGTTTCCTCAGTATGCTCAGCTTTATGAAGGTAATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa940
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022043 Nonsense 375 614 5 9
ENSDART00000051333 Nonsense 375 1076 5 14
ENSDART00000127383 Nonsense 375 1076 5 14
Genomic Location (Zv9):
Chromosome 5 (position 37461844)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35243793
GRCz11 5 35843946
KASP Assay ID:
554-0845.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCACAAGCCTGGAACTTTCCCCAAATCTCTGTCAATTGAAAGTCTCTG[T/A]CCTGTCTCTGTTTCTGAAAGTCCTGACCATATTGACTGGGCAGRAGTAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link