
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ern1
- Ensembl ID:
- ENSDARG00000013997
- ZFIN ID:
- ZDB-GENE-050522-431
- Description:
- endoplasmic reticulum to nucleus signaling 1 [Source:RefSeq peptide;Acc:NP_001018366]
- Human Orthologue:
- ERN1
- Human Description:
- endoplasmic reticulum to nucleus signaling 1 [Source:HGNC Symbol;Acc:3449]
- Mouse Orthologue:
- Ern1
- Mouse Description:
- endoplasmic reticulum (ER) to nucleus signalling 1 Gene [Source:MGI Symbol;Acc:MGI:1930134]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa40179 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa40179
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014182 | Nonsense | 283 | 1031 | 8 | 22 |
ENSDART00000144638 | Nonsense | 283 | 751 | 8 | 22 |
- Genomic Location (Zv9):
- Chromosome 3 (position 56313823)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 55190145 GRCz11 3 55448756 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGAGGTGGGCCGCATCACACAGTGGAAGTATCCATTTCCTCGAGAAAAG[A/T]AAACCAAAGATAAACTGTTGTAAGTAGCCCCTTTAACTCCTTTTATTTTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: