zgc:55604

Ensembl ID:
ENSDARG00000013928
ZFIN ID:
ZDB-GENE-040426-754
Description:
pleckstrin homology domain-containing family B member 2 [Source:RefSeq peptide;Acc:NP_957296]
Human Orthologue:
PLEKHB2
Human Description:
pleckstrin homology domain containing, family B (evectins) member 2 [Source:HGNC Symbol;Acc:19236]
Mouse Orthologue:
Plekhb2
Mouse Description:
pleckstrin homology domain containing, family B (evectins) member 2 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29751 Essential Splice Site Mutation detected in F1 DNA During 2018
sa37480 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa29751
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006290 Essential Splice Site 140 223 6 8
Genomic Location (Zv9):
Chromosome 22 (position 16660024)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16411782
GRCz11 22 16438052
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGCATCGGCTCCTCCACCATATTCTGAGCTAAACCCAACTCCACAGG[T/A]ATTTGTGTAATTTTTTTATTTTATTGAAGATATCCAGGTTATTTGGTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37480
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006290 Nonsense 168 223 7 8
Genomic Location (Zv9):
Chromosome 22 (position 16659092)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16410850
GRCz11 22 16437120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCTCATCCTCCACCATATGCGACACAGATGGTTTACTCAGCCGACGGG[C/T]AGCAGTATGCAGTCGCCTACCCTTATCACTATCAAGGTAACCCTAAATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link