SORL1

Ensembl ID:
ENSDARG00000013892
Description:
sortilin-related receptor, L(DLR class) A repeats-containing [Source:HGNC Symbol;Acc:11185]
Human Orthologue:
SORL1
Human Description:
sortilin-related receptor, L(DLR class) A repeats-containing [Source:HGNC Symbol;Acc:11185]
Mouse Orthologue:
Sorl1
Mouse Description:
sortilin-related receptor, LDLR class A repeats-containing Gene [Source:MGI Symbol;Acc:MGI:1202296]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6374 Nonsense Mutation detected in F1 DNA During 2018
sa6373 Nonsense Mutation detected in F1 DNA During 2018
sa45536 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32030 Nonsense Available for shipment Available now
sa1275 Essential Splice Site Available for shipment Available now
sa22633 Nonsense Available for shipment Available now
sa774 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa6374
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011416 Nonsense 323 2045 7 44
Genomic Location (Zv9):
Chromosome 15 (position 20561876)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21664502
GRCz11 15 21600234
KASP Assay ID:
554-4269.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCGATGTRAACGTGTTTCCACAGGCATTATTGGGGAGCCACGAGTCT[C/T]AGTCTGTYCAGCYCTGGGTTTCTTACAACYGACAGCCAATGAGAGCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6373
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011416 Nonsense 333 2045 7 44
Genomic Location (Zv9):
Chromosome 15 (position 20561846)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21664472
GRCz11 15 21600204
KASP Assay ID:
554-4926.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTGGGGAGCCACGAGTCTYAGTCTGTYCAGCYCTGGGTTTCTTACAAC[C/T]GACAGCCAATGAGAGCAGCTCAGTTTAACACYCGTCACCCAATCACAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45536
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011416 Essential Splice Site 1595 2045 34 44
Genomic Location (Zv9):
Chromosome 15 (position 20518718)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21621344
GRCz11 15 21557076
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCTAAAAATATGCCTACATCCTCCTGTTCTTTTGTCATCTACTTCAGG[T/A]AAAGCAGGGACTGGATAAATCTATCCTTTTTTAATTTATATTTTTAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32030
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011416 Nonsense 1721 2045 37 44
Genomic Location (Zv9):
Chromosome 15 (position 20515887)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21618513
GRCz11 15 21554245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCACCAGCACTAACGCAGAAGTGAAGAACCTGCAGCCCAGCTCGCTCTA[C/A]AGATTTAGGGTGAGATGCTCTGAGATCCTGCATGCTGCTGTTTCATGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1275
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011416 Essential Splice Site 1747 2045 38 44
Genomic Location (Zv9):
Chromosome 15 (position 20515721)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21618347
GRCz11 15 21554079
KASP Assay ID:
554-1190.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGCGTTGGAAACTGGACAGAAATAAAGTCTATTATTCCTCAAAAAGG[T/A]AATTATGCTGTATAAACCCCATTGCGGAGCACTGGCTCCCCCTGCTGGAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa22633
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011416 Nonsense 1778 2045 40 44
Genomic Location (Zv9):
Chromosome 15 (position 20513878)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21616504
GRCz11 15 21552236
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGGCATTATTAAAATATTTAACTCGCTTTCTGTTAGGTGAAGCTCTA[T/A]ATTGTAGTAATTTCTTGGGTATTTGATGAACATGTTAAGGAGAGCTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa774
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011416 Nonsense 1919 2045 43 44
Genomic Location (Zv9):
Chromosome 15 (position 20510313)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21612939
GRCz11 15 21548671
KASP Assay ID:
554-0679.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGTTTAGGTGCGAGTGGTTTCTCCATACATGGGTCCTCCATCAAACTA[T/A]GCTGTAGTGAAGATGATCCCAGATGAGCGCCTTCCACCTCGTAACCTGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link