SPATA20

Ensembl ID:
ENSDARG00000013880
Description:
spermatogenesis associated 20 [Source:HGNC Symbol;Acc:26125]
Human Orthologue:
SPATA20
Human Description:
spermatogenesis associated 20 [Source:HGNC Symbol;Acc:26125]
Mouse Orthologue:
Spata20
Mouse Description:
spermatogenesis associated 20 Gene [Source:MGI Symbol;Acc:MGI:2183449]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22115 Nonsense Available for shipment Available now
sa22116 Nonsense Available for shipment Available now
sa13025 Nonsense Available for shipment Available now
sa15455 Nonsense Available for shipment Available now
sa44766 Splice Site, Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa22115
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066288 Nonsense 104 818 2 16
Genomic Location (Zv9):
Chromosome 12 (position 29162275)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27499884
GRCz11 12 27591244
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAAGACCCCAAAGTATACCAACCGCCTGAGTCAAGAGAAGTCCTCCTA[T/A]CTTTTACAACATGCACACAACCCTGTGGACTGGTGAGGGTCTCTGAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22116
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066288 Nonsense 128 818 3 16
Genomic Location (Zv9):
Chromosome 12 (position 29164482)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27502091
GRCz11 12 27593451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTGAACAGGTATCCATGGGGCCAAGAAGCCTTTGATAAAGCAAAATG[T/A]GAAGACAAGCCTATTTTTCTTTCAGGTAACGTAATATTATACTTGAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13025
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066288 Nonsense 412 818 10 16
Genomic Location (Zv9):
Chromosome 12 (position 29169758)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27507367
GRCz11 12 27598727
KASP Assay ID:
2260-5469.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATTTGAKTTTGAGCATTGTGCTGCCCTCTGCAGTCTGGCGGCTTCTA[T/G]AGCGCTGAGGATGCAGAYTCCTTTCCCAYAGTGGAGTCCACAGAGAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15455
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066288 Nonsense 412 818 10 16
Genomic Location (Zv9):
Chromosome 12 (position 29169758)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27507367
GRCz11 12 27598727
KASP Assay ID:
2260-5469.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATTTGAKTTTGAGCATTGTGCTGCCCTCTGCAGTCTGGCGGCTTCTA[T/G]AGCGCTGAGGATGCAGAYTCCTTTCCCAYAGTGGAGTCCACAGAGAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44766
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066288 Splice Site, Nonsense 735 818 14 16
Genomic Location (Zv9):
Chromosome 12 (position 29193443)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27531052
GRCz11 12 27622412
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTGCCAGACATGGTCCGCGGTGTCATGGCCCACCATTACACTCTTAAA[C/T]AGGTAACGGCAGACTGGAGTACAGGCTACTGAATATGCAGTTTAAAGGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link