si:dkeyp-84g9.1

Ensembl ID:
ENSDARG00000013838
ZFIN ID:
ZDB-GENE-030131-775
Description:
extracellular sulfatase Sulf-2 [Source:RefSeq peptide;Acc:NP_001003833]
Human Orthologue:
SULF2
Human Description:
sulfatase 2 [Source:HGNC Symbol;Acc:20392]
Mouse Orthologue:
Sulf2
Mouse Description:
sulfatase 2 Gene [Source:MGI Symbol;Acc:MGI:1919293]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1483 Nonsense Available for shipment Available now
sa37649 Nonsense Mutation detected in F1 DNA During 2018
sa25195 Essential Splice Site Mutation detected in F1 DNA During 2018
sa1414 Nonsense Available for shipment Available now
sa32434 Nonsense Available for shipment Available now
sa43930 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa1483
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035865 Nonsense 34 885 2 21
ENSDART00000104904 Nonsense 34 867 2 20
ENSDART00000131649   None 321 None 6
ENSDART00000139135 Nonsense 34 867 1 19
ENSDART00000143635 Nonsense 34 61 2 2
Genomic Location (Zv9):
Chromosome 23 (position 15395702)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15528581
GRCz11 23 15284658
KASP Assay ID:
554-1408.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATGTTGGCAGTAGCTCATGCCTCCATCTTCCTGTCYAAYCAGAGACTC[A/T]AACCYCGATTCCAACGAGACCGTCGAAACATCCGGCCCAACATCATCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37649
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035865 Nonsense 42 885 2 21
ENSDART00000104904 Nonsense 42 867 2 20
ENSDART00000131649   None 321 None 6
ENSDART00000139135 Nonsense 42 867 1 19
ENSDART00000143635 Nonsense 42 61 2 2
Genomic Location (Zv9):
Chromosome 23 (position 15395678)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15528557
GRCz11 23 15284634
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCTTCCTGTCCAATCAGAGACTCAAACCTCGATTCCAACGAGACCGT[C/T]GAAACATCCGGCCCAACATCATCCTTATCCTCACTGATGATCAGGACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25195
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035865 Essential Splice Site 648 885 13 21
ENSDART00000104904 Essential Splice Site 648 867 13 20
ENSDART00000131649   None 321 None 6
ENSDART00000139135 Essential Splice Site 648 867 12 19
ENSDART00000143635   None 61 None 2
Genomic Location (Zv9):
Chromosome 23 (position 15328950)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15461829
GRCz11 23 15217906
KASP Assay ID:
554-7341.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATCACTGCAGGCCTGGAAAGACCACAAGCTGCACATCGACCATGAAG[T/G]ATGACACACATCTAGAGATGCCAAAGATTAATCGATCATTATTACTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1414
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035865 Nonsense 804 885 17 21
ENSDART00000104904 Nonsense 804 867 17 20
ENSDART00000131649 Nonsense 139 321 4 6
ENSDART00000139135 Nonsense 804 867 16 19
ENSDART00000143635   None 61 None 2
Genomic Location (Zv9):
Chromosome 23 (position 15324103)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15456982
GRCz11 23 15213059
KASP Assay ID:
554-1335.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTTTGCCACTGGCTTTCTGGAGTACTTTGACATCAACACAGATCCATA[T/G]CAGGTCAGTGGTCAAATATAAAGACAGCATGAAAACACTGCTGAAGATTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa32434
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035865 Nonsense 805 885 17 21
ENSDART00000104904 Nonsense 805 867 17 20
ENSDART00000131649 Nonsense 140 321 4 6
ENSDART00000139135 Nonsense 805 867 16 19
ENSDART00000143635   None 61 None 2
Genomic Location (Zv9):
Chromosome 23 (position 15324102)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15456981
GRCz11 23 15213058
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTGCCACTGGCTTTCTGGAGTACTTTGACATCAACACAGATCCATAT[C/T]AGGTCAGTGGTCAAATATAAAGACAGCATGAAAACACTGCTGAAGATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43930
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035865 Essential Splice Site 858 885 20 21
ENSDART00000104904   None 867 None 20
ENSDART00000131649   None 321 None 6
ENSDART00000139135   None 867 None 19
ENSDART00000143635   None 61 None 2
Genomic Location (Zv9):
Chromosome 23 (position 15317662)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15450541
GRCz11 23 15206618
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTTTGGGGGTGGGGGTAACAGTTTGTCTTATCGTTGCTTGTCGCATT[A/G]GGCAGTTTCAGCGCCGGAAATGGCCTAAAGTGAGGAAGCCTGTCTCCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link