zgc:113125

Ensembl ID:
ENSDARG00000013828
ZFIN ID:
ZDB-GENE-050306-12
Description:
Zgc:113125 [Source:UniProtKB/TrEMBL;Acc:Q5CZT6]
Human Orthologue:
SNX13
Human Description:
sorting nexin 13 [Source:HGNC Symbol;Acc:21335]
Mouse Orthologue:
Snx13
Mouse Description:
sorting nexin 13 Gene [Source:MGI Symbol;Acc:MGI:2661416]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36750 Nonsense Mutation detected in F1 DNA During 2018
sa23409 Nonsense Available for shipment Available now
sa36749 Essential Splice Site Mutation detected in F1 DNA During 2018
sa16799 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36750
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020497 Nonsense 289 961 9 25
ENSDART00000063615   None 228 None 8
Genomic Location (Zv9):
Chromosome 19 (position 2213819)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 2119825
GRCz11 19 2086895
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTCCCTAATGGTGTGTGCATTTAGATCCGTGACTCGAGCTGTAACTA[C/A]GAGGCCTTCCTGAACATCTTAAAGCTGACAGACGAGCCGTCCGAGCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23409
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020497 Nonsense 417 961 12 25
ENSDART00000063615   None 228 None 8
Genomic Location (Zv9):
Chromosome 19 (position 2210219)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 2116225
GRCz11 19 2083295
KASP Assay ID:
2261-2769.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATTCTGTTCTTCTGGCTGACGGTGGAGGGCTATCGGGTGACAGCACAG[C/T]AGCAGCTGGAGGTCCTACAGAGCTGTCAGAGAGATGGCAAGAGGCAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36749
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020497 Essential Splice Site 818 961 23 25
ENSDART00000063615   None 228 None 8
Genomic Location (Zv9):
Chromosome 19 (position 2193635)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 2099641
GRCz11 19 2066711
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAACAAGGAATCTGAAAAGTAAATAATTGAATAATGAGCATGTATTTC[G/A]TCTCATGGCAGGAAAATCGTAGATCACGTGGACAACATGACGTCTCCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16799
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020497 Nonsense 851 961 24 25
ENSDART00000063615 Nonsense 118 228 7 8
Genomic Location (Zv9):
Chromosome 19 (position 2193453)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 2099459
GRCz11 19 2066529
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTTGTCTTCTGATTGGTGTTTTTTTGACTMTGCAGAGACTCTTATTG[G/A]CCGAACGGGATCCTGGCCGAGACGCCACCCCGCAGAGACAAAAACCTSCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link