zgc:110659

Ensembl ID:
ENSDARG00000013822
ZFIN ID:
ZDB-GENE-050417-430
Description:
hypothetical protein LOC550576 [Source:RefSeq peptide;Acc:NP_001017878]
Human Orthologue:
ANAPC16
Human Description:
anaphase promoting complex subunit 16 [Source:HGNC Symbol;Acc:26976]
Mouse Orthologue:
Anapc16
Mouse Description:
anaphase promoting complex subunit 16 Gene [Source:MGI Symbol;Acc:MGI:1289325]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31897 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31897
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126362 Essential Splice Site 24 136 1 4
Genomic Location (Zv9):
Chromosome 12 (position 49612562)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48335935
GRCz11 12 48319257
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCATCAAAACACACTGAAGTAAAAACAGCGGCGGATCGAGCTACACGG[G/A]TAAACAACAAATATTACACACTGTAAACAAACATTGCGATTTATTCTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link