zgc:112221

Ensembl ID:
ENSDARG00000013813
ZFIN ID:
ZDB-GENE-050522-213
Description:
hypothetical protein LOC553801 [Source:RefSeq peptide;Acc:NP_001018599]
Human Orthologue:
C9orf25
Human Description:
chromosome 9 open reading frame 25 [Source:HGNC Symbol;Acc:19920]
Mouse Orthologue:
2310028H24Rik
Mouse Description:
RIKEN cDNA 2310028H24 gene Gene [Source:MGI Symbol;Acc:MGI:1919151]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38470 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38470
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010199 Essential Splice Site 114 191 4 6
ENSDART00000145096 Essential Splice Site 114 184 4 6
Genomic Location (Zv9):
Chromosome 5 (position 27732988)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25488286
GRCz11 5 26088439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGACCAGAGTCCAGATGAGAAACCTTTAGTTGCTCTAGACACAGACAGG[T/C]AAGCTCTTCACTCATCCTGCACTCATTTATTTATGTCCCCATCGGCTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link