sim1b

Ensembl ID:
ENSDARG00000013789
ZFIN ID:
ZDB-GENE-041210-5
Description:
single-minded homolog 1b [Source:RefSeq peptide;Acc:NP_001153057]
Human Orthologue:
SIM1
Human Description:
single-minded homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:10882]
Mouse Orthologue:
Sim1
Mouse Description:
single-minded homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:98306]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14238 Missense, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14238
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023483 Nonsense 69 586 2 11
ENSDART00000137580 Nonsense 69 421 2 10
ENSDART00000141639 Missense 65 74 2 6
Genomic Location (Zv9):
Chromosome 4 (position 712812)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 930728
GRCz11 4 944176
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTNNNNNNCTGTGTTTGGTWTYTTTAGGTTTGGGAGAGGTGTGGGGTCAAGCGGGG[C/T]GAACCAGATCTGGAGAAAACCCATCCCATGAGCTCGGATCTCATTTACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link