zgc:77158

Ensembl ID:
ENSDARG00000013784
ZFIN ID:
ZDB-GENE-040426-1799
Description:
solute carrier family 45 member 3 [Source:RefSeq peptide;Acc:NP_991235]
Human Orthologue:
SLC45A3
Human Description:
solute carrier family 45, member 3 [Source:HGNC Symbol;Acc:8642]
Mouse Orthologue:
Slc45a3
Mouse Description:
solute carrier family 45, member 3 Gene [Source:MGI Symbol;Acc:MGI:1922082]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12759 Nonsense Available for shipment Available now
sa10038 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12759
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020259 Nonsense 43 551 2 6
Genomic Location (Zv9):
Chromosome 25 (position 17273320)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16819864
GRCz11 25 16916264
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGCATCACTTATGTGCCACCGTTGTTACTGGAGGCCGGCGTGGAGGAA[C/T]AGTACATGACCATGGTTTTAGGTAAGGTTCGGTGCCAGCTTTTGTATRTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10038
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020259 Nonsense 288 551 3 6
Genomic Location (Zv9):
Chromosome 25 (position 17289426)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16835970
GRCz11 25 16932370
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACGTGCCACGTGTCATGCGGCAGCTGTGTTTGGCACAGCTCTGCAGCTG[G/A]ATGGGCGTCATGTCCTTCATGCTCTTCTACACTGATTTTGTGGGTGAGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link