si:dkey-246g23.4

Ensembl ID:
ENSDARG00000013775
ZFIN ID:
ZDB-GENE-050419-234
Description:
hypothetical protein LOC559426 [Source:RefSeq peptide;Acc:NP_001106809]
Human Orthologues:
AC037487.1, SLC16A1, SLC16A3, SLC16A5, SLC16A6, SLC16A7, SLC16A8
Human Descriptions:
solute carrier family 16, member 1 (monocarboxylic acid transporter 1) [Source:HGNC Symbol;Acc:10922
solute carrier family 16, member 3 (monocarboxylic acid transporter 4) [Source:HGNC Symbol;Acc:10924
solute carrier family 16, member 5 (monocarboxylic acid transporter 6) [Source:HGNC Symbol;Acc:10926
solute carrier family 16, member 6 (monocarboxylic acid transporter 7) [Source:HGNC Symbol;Acc:10927
solute carrier family 16, member 7 (monocarboxylic acid transporter 2) [Source:HGNC Symbol;Acc:10928
solute carrier family 16, member 8 (monocarboxylic acid transporter 3) [Source:HGNC Symbol;Acc:16270
Mouse Orthologues:
Slc16a1, Slc16a3, Slc16a5, Slc16a6, Slc16a7, Slc16a8
Mouse Descriptions:
solute carrier family 16 (monocarboxylic acid transporters), member 1 Gene [Source:MGI Symbol;Acc:MG
solute carrier family 16 (monocarboxylic acid transporters), member 3 Gene [Source:MGI Symbol;Acc:MG
solute carrier family 16 (monocarboxylic acid transporters), member 5 Gene [Source:MGI Symbol;Acc:MG
solute carrier family 16 (monocarboxylic acid transporters), member 6 Gene [Source:MGI Symbol;Acc:MG
solute carrier family 16 (monocarboxylic acid transporters), member 7 Gene [Source:MGI Symbol;Acc:MG
solute carrier family 16 (monocarboxylic acid transporters), member 8 Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28999 Nonsense Mutation detected in F1 DNA During 2018
sa10653 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa28999
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009363 Nonsense 5 425 1 5
ENSDART00000125033 Nonsense 5 457 1 4
ENSDART00000136120 Nonsense 5 121 3 4
ENSDART00000141813 Nonsense 5 118 3 4
Genomic Location (Zv9):
Chromosome 18 (position 14152987)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14598405
GRCz11 18 14566917
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTTTGTAGTTGTAGGATGATCTATTAAGCTTTCAATGGAAAGGAAG[A/T]GAGGAACAGCCGGGCCTGCAGGTCCTCCTCTGGATGGTGGTTATGGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10653
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009363 Nonsense 21 425 1 5
ENSDART00000125033 Nonsense 21 457 1 4
ENSDART00000136120 Nonsense 21 121 3 4
ENSDART00000141813 Nonsense 21 118 3 4
Genomic Location (Zv9):
Chromosome 18 (position 14153037)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14598455
GRCz11 18 14566967
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGAACAGCCGGGCCTGCAGGTCCTCCTCTGGATGGTGGTTATGGCTG[G/A]KTCATTGTGCTCTCCACTTTYCTTGTGTTTGGGCTGACGTTCGGCGTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link