Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:73056
- Ensembl ID:
- ENSDARG00000013750
- ZFIN ID:
- ZDB-GENE-040426-1651
- Description:
- zgc:73056 [Source:RefSeq peptide;Acc:NP_956989]
- Human Orthologue:
- ENO1
- Human Description:
- enolase 1, (alpha) [Source:HGNC Symbol;Acc:3350]
- Mouse Orthologues:
- Eno1, Gm5506
- Mouse Descriptions:
- enolase 1, alpha non-neuron Gene [Source:MGI Symbol;Acc:MGI:95393]
- predicted gene 5506 Gene [Source:MGI Symbol;Acc:MGI:3648653]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa30876 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa40761 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa30876
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000103842 | Nonsense | 5 | 433 | 2 | 12 |
| ENSDART00000142492 | None | 374 | None | 9 |
- Genomic Location (Zv9):
- Chromosome 6 (position 40593498)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 40665098 GRCz11 6 40662634 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATAATCTATCTTTTTATCAATTAGATTTTTAAAGAAAGATGTCTATTCTG[A/T]AGATACACGCTCGTGAGATTTTTGATTCTAGGGGCAACCCCACTGTGGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40761
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000103842 | Nonsense | 163 | 433 | 7 | 12 |
| ENSDART00000142492 | Nonsense | 104 | 374 | 4 | 9 |
- Genomic Location (Zv9):
- Chromosome 6 (position 40596328)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 40667928 GRCz11 6 40665464 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCAAAGGCCTTTAATGTGATCAATGGCGGCTCTCATGCTGGCAATAAAT[T/A]GGCCATGCAGGAGTTCATGATTCTGCCGGTCGGGGCCAGCAGCTTTAAGG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Autism spectrum disorder, attention deficit-hyperactivity disorder, bipolar disorder, major depressive disorder, and schizophrenia (combined): Identification of risk loci with shared effects on five major psychiatric disorders: a genome-wide analysis. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
