zgc:92113

Ensembl ID:
ENSDARG00000013749
ZFIN ID:
ZDB-GENE-040801-184
Description:
hypothetical protein LOC445054 [Source:RefSeq peptide;Acc:NP_001003448]
Human Orthologues:
SLC25A18, SLC25A22
Human Descriptions:
solute carrier family 25 (mitochondrial carrier), member 18 [Source:HGNC Symbol;Acc:10988]
solute carrier family 25 (mitochondrial carrier: glutamate), member 22 [Source:HGNC Symbol;Acc:19954
Mouse Orthologues:
Slc25a18, Slc25a22
Mouse Descriptions:
solute carrier family 25 (mitochondrial carrier), member 18 Gene [Source:MGI Symbol;Acc:MGI:1919053]
solute carrier family 25 (mitochondrial carrier, glutamate), member 22 Gene [Source:MGI Symbol;Acc:M

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11993 Nonsense Available for shipment Available now
sa43898 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa11993
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008177 Nonsense 25 331 2 9
Genomic Location (Zv9):
Chromosome 23 (position 427353)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 398344
GRCz11 23 411137
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGCCAAGCTCATCAATGGCGGAGTTGCGGGACTGGTGGGCGTCACCTG[C/A]GTCTTTCCCATTGATCTGGCCAAAACCAGACTGCAGAACCAAAGAGGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43898
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008177 Essential Splice Site 279 331 8 9
Genomic Location (Zv9):
Chromosome 23 (position 432544)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 403535
GRCz11 23 416328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAAAAGCGCAAACGAGGATACCTACAATGGCGTAGTGGACTGCATCAG[G/A]TACAGTAACAAAACATTCTCCTGGGGAAGAGAATCAGCAGGCATTAGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link