vta1

Ensembl ID:
ENSDARG00000013732
ZFIN ID:
ZDB-GENE-040426-2154
Description:
vacuolar protein sorting-associated protein VTA1 homolog [Source:RefSeq peptide;Acc:NP_998305]
Human Orthologue:
VTA1
Human Description:
Vps20-associated 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:20954]
Mouse Orthologue:
Vta1
Mouse Description:
Vps20-associated 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1913451]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37116 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37116
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067053 Essential Splice Site 62 302 2 8
Genomic Location (Zv9):
Chromosome 20 (position 37351668)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 37424181
GRCz11 20 37327060
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGAGTGTCGAAAGTTTCTTGTGAAACTAATGGATCAGTTGGAAATGG[T/C]AAGTTTGAAAAGTTTTTTAATTAATGTTTTATCTCCATATCATTACCGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link