srsf6a

Ensembl ID:
ENSDARG00000013729
ZFIN ID:
ZDB-GENE-040426-2824
Description:
serine/arginine-rich splicing factor 6a [Source:RefSeq peptide;Acc:NP_998631]
Human Orthologue:
SRSF6
Human Description:
serine/arginine-rich splicing factor 6 [Source:HGNC Symbol;Acc:10788]
Mouse Orthologue:
Srsf6
Mouse Description:
serine/arginine-rich splicing factor 6 Gene [Source:MGI Symbol;Acc:MGI:1915246]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32423 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32423
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020251 Nonsense 127 379 4 7
ENSDART00000103747 Nonsense 95 347 3 6
Genomic Location (Zv9):
Chromosome 23 (position 4319008)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 4329032
GRCz11 23 4267933
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCACTGAGTATCGGCTCATTGTGGAGAATCTGTCTAGTCGCTGCAGCT[G/A]GCAAGACCTAAAGGTAATGGTGGTAAAATGGCACACAACAACCCTGTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link