zgc:101706

Ensembl ID:
ENSDARG00000013659
ZFIN ID:
ZDB-GENE-041114-137
Description:
BRO1 domain-containing protein BROX [Source:UniProtKB/Swiss-Prot;Acc:A3KQV2]
Human Orthologue:
C1orf58
Human Description:
chromosome 1 open reading frame 58 [Source:HGNC Symbol;Acc:26512]
Mouse Orthologue:
0610010K06Rik
Mouse Description:
RIKEN cDNA 0610010K06 gene Gene [Source:MGI Symbol;Acc:MGI:1918928]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17983 Essential Splice Site Available for shipment Available now
sa10229 Essential Splice Site Available for shipment Available now
sa43546 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa17983
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004092 Essential Splice Site 102 411 5 14
ENSDART00000147044 Essential Splice Site 102 411 5 13
ENSDART00000004092 Essential Splice Site 102 411 5 14
ENSDART00000147044 Essential Splice Site 102 411 5 13
Genomic Location (Zv9):
Chromosome 20 (position 52059403)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 51908641
GRCz11 20 51720546
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGATAAATTGAATAAAAATGAATARAANTGGMAACTGTGTGTGTTTCA[G/T]TGCGCAGCAGGATGCCGTGTTTGAGCTGGTGTCTATGGCCTTTAATGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10229
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004092 Essential Splice Site 102 411 5 14
ENSDART00000147044 Essential Splice Site 102 411 5 13
ENSDART00000004092 Essential Splice Site 102 411 5 14
ENSDART00000147044 Essential Splice Site 102 411 5 13
Genomic Location (Zv9):
Chromosome 20 (position 52059403)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 51908641
GRCz11 20 51720546
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGATAAATTGAATAAAAATGAATARAATGGMAACTGTGTGTGTTTCA[G/T]TGCGCAGCAGGATGCCGTGTTTGAGCTGGTGTCTATGGCCTTTAATGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43546
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004092 Essential Splice Site 224 411 8 14
ENSDART00000147044 Essential Splice Site 224 411 8 13
Genomic Location (Zv9):
Chromosome 20 (position 52051909)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 51901147
GRCz11 20 51713052
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATTGCAGCGCTGGCCTTCGAGACTGCCAACTTCTACCAGAAAGCCGG[T/C]GAGTTTTACTTTAATAATATATTAATTAAGAATTTAATCTATTATTAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link