zgc:63629

Ensembl ID:
ENSDARG00000013653
ZFIN ID:
ZDB-GENE-040426-2689
Description:
EGF, latrophilin and seven transmembrane domain containing 1 [Source:RefSeq peptide;Acc:NP_998532]
Human Orthologue:
ELTD1
Human Description:
EGF, latrophilin and seven transmembrane domain containing 1 [Source:HGNC Symbol;Acc:20822]
Mouse Orthologue:
Eltd1
Mouse Description:
EGF, latrophilin seven transmembrane domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2655562]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35023 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35023
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009859 Nonsense 706 727 15 16
Genomic Location (Zv9):
Chromosome 11 (position 7529695)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7373798
GRCz11 11 7383637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAATGTGTTCCAAGGGATGTTCATTTTCATATTCCTTTGCGTTCTGTCC[A/T]GAAGGGTAAGGTTCATATTCCTGTGCAAGTTTCACATTTAATTTATTTCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link