
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-273a21.1
- Ensembl ID:
- ENSDARG00000013647
- ZFIN ID:
- ZDB-GENE-090312-57
- Human Orthologues:
- CNTN1, CNTN2, CNTN5
- Human Descriptions:
- contactin 1 [Source:HGNC Symbol;Acc:2171]
- contactin 2 (axonal) [Source:HGNC Symbol;Acc:2172]
- contactin 5 [Source:HGNC Symbol;Acc:2175]
- Mouse Orthologues:
- Cntn1, Cntn2, Cntn5
- Mouse Descriptions:
- contactin 1 Gene [Source:MGI Symbol;Acc:MGI:105980]
- contactin 2 Gene [Source:MGI Symbol;Acc:MGI:104518]
- contactin 5 Gene [Source:MGI Symbol;Acc:MGI:3042287]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa1947 | Nonsense | Available for shipment | Available now |
sa1280 | Nonsense | Available for shipment | Available now |
sa32427 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa1947
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104954 | Nonsense | 110 | 966 | 3 | 22 |
ENSDART00000131232 | Nonsense | 110 | 929 | 3 | 19 |
- Genomic Location (Zv9):
- Chromosome 23 (position 11215423)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 11174225 GRCz11 23 11109195 - KASP Assay ID:
- 554-1935.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CATTTGCATGGGTCTTTAAYGAGTACCCTTACTTTGTTCAGCAAGACAAT[C/T]GACGCTTTGTCTCTCAGGAGACGGGAAACCTTTACATCGCCAAAGTGGAG
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa1280
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104954 | Nonsense | 486 | 966 | 10 | 22 |
ENSDART00000131232 | Nonsense | 486 | 929 | 10 | 19 |
- Genomic Location (Zv9):
- Chromosome 23 (position 11160230)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 11119032 GRCz11 23 11054002 - KASP Assay ID:
- 554-1195.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATGTCTCGTTCTCTTGGGCCTTCAATGGGCAGCTGCTCAGTAAACTCGAC[C/T]AACATTATGAGCATGTGGGTGGGGTAAGTCAGACTTTACTACGTCTATAT
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa32427
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104954 | Nonsense | 761 | 966 | 16 | 22 |
ENSDART00000131232 | Nonsense | 760 | 929 | 16 | 19 |
- Genomic Location (Zv9):
- Chromosome 23 (position 11130384)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 11089186 GRCz11 23 11024156 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GACGGCGTGTGGGCCAGAAGCATCTCCGCCACTGAAATTGAAGTGAGCTG[G/A]CACATCCTCAGCGTTTCAACAGAAAGAGTGTTGGGCTATGAGGTGCGTCC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Bipolar disorder and schizophrenia: A genome-wide meta-analysis identifies novel loci associated with schizophrenia and bipolar disorder. (View Study)
- Immune response to smallpox vaccine (IL-6): Genome-wide analysis of polymorphisms associated with cytokine responses in smallpox vaccine recipients. (View Study)
- Major CVD: Framingham Heart Study 100K project: genome-wide associations for cardiovascular disease outcomes. (View Study)
- Myopia (pathological): A genome-wide association study provides evidence for association of chromosome 8p23 (MYP10) and 10q21.1 (MYP15) with high myopia in the French Population. (View Study)
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
- Protein quantitative trait loci: A genome-wide association study identifies protein quantitative trait loci (pQTLs). (View Study)
- Volumetric brain MRI: Genetic correlates of brain aging on MRI and cognitive test measures: a genome-wide association and linkage analysis in the Framingham Study. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: