vdac2

Ensembl ID:
ENSDARG00000013623
ZFIN ID:
ZDB-GENE-030131-845
Description:
voltage-dependent anion-selective channel protein 2 [Source:RefSeq peptide;Acc:NP_955879]
Human Orthologue:
VDAC2
Human Description:
voltage-dependent anion channel 2 [Source:HGNC Symbol;Acc:12672]
Mouse Orthologue:
Vdac2
Mouse Description:
voltage-dependent anion channel 2 Gene [Source:MGI Symbol;Acc:MGI:106915]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22261 Nonsense Available for shipment Available now
sa22260 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22261
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013011 Nonsense 62 283 4 9
ENSDART00000126016 Nonsense 62 283 3 8
Genomic Location (Zv9):
Chromosome 13 (position 17771899)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 17591934
GRCz11 13 17722926
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCCAACACTGACACCAGCAAAGTGGTTGGGAGCCTGGAAACCAAATA[C/A]AAGAGGTCTGAATATGGCCTGACCTTCACAGAGAAGTGGAATACCGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22260
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013011 Nonsense 225 283 7 9
ENSDART00000126016 Nonsense 225 283 6 8
Genomic Location (Zv9):
Chromosome 13 (position 17766602)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 17586637
GRCz11 13 17717629
KASP Assay ID:
2260-6230.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGGACAGCAGGAAGCAACAGCACACGCTTTGGAATTGCTGCCAAGTA[T/A]CAGCTGGACAAAGACGCCTCCATCAGTGTGAGTAAACGGCACGTTTTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link