
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rfx2
- Ensembl ID:
- ENSDARG00000013575
- ZFIN ID:
- ZDB-GENE-050227-4
- Description:
- DNA-binding protein RFX2 [Source:UniProtKB/Swiss-Prot;Acc:Q5EAP5]
- Human Orthologue:
- RFX2
- Human Description:
- regulatory factor X, 2 (influences HLA class II expression) [Source:HGNC Symbol;Acc:9983]
- Mouse Orthologue:
- Rfx2
- Mouse Description:
- regulatory factor X, 2 (influences HLA class II expression) Gene [Source:MGI Symbol;Acc:MGI:106583]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa14019 | Nonsense | Available for shipment | Available now |
sa31644 | Nonsense | Available for shipment | Available now |
sa21260 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa14019
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000029939 | Nonsense | 113 | 734 | 5 | 18 |
ENSDART00000122943 | Nonsense | 113 | 738 | 4 | 18 |
ENSDART00000132218 | Nonsense | 83 | 189 | 4 | 6 |
ENSDART00000133141 | Nonsense | 83 | 234 | 5 | 7 |
ENSDART00000147634 | Nonsense | 83 | 170 | 4 | 5 |
- Genomic Location (Zv9):
- Chromosome 8 (position 20638559)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 20068456 GRCz11 8 20100541 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCTTATAAYCCAGAGTCCCAGCTATATGGTCAGGGCAGTGGAAGTGCCTA[T/A]TTCGACTCTCAGGCGGGTGGTGCTCAGGTAACCACAGTCGTCTCTTCTGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31644
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000029939 | Nonsense | 403 | 734 | 11 | 18 |
ENSDART00000122943 | Nonsense | 403 | 738 | 10 | 18 |
ENSDART00000132218 | None | 189 | None | 6 | |
ENSDART00000133141 | None | 234 | None | 7 | |
ENSDART00000147634 | None | 170 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 8 (position 20622040)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 20051937 GRCz11 8 20084022 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTCTGGATGTTGTGATGAACCTGCAATTTCATCTCATAGAGAAGCTGTG[G/A]CAGACCTTTTGGCATTCAACAGCGCCCTCTAGTGACGGAGCCACTACCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21260
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000029939 | None | 734 | 18 | 18 | |
ENSDART00000122943 | Nonsense | 727 | 738 | 18 | 18 |
ENSDART00000132218 | None | 189 | None | 6 | |
ENSDART00000133141 | None | 234 | None | 7 | |
ENSDART00000147634 | None | 170 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 8 (position 20612354)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 20042251 GRCz11 8 20074336 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCGTGTGTCTCCTTTAGGTTTTCTGCGACTGTGAAGCAAGAATGTGCTG[G/A]TTTGGTGGCGTGTGGTTTATTTTTCATGTGCCATAGTCTTCTTTCAGTGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: