zgc:175248

Ensembl ID:
ENSDARG00000013544
ZFIN ID:
ZDB-GENE-080204-93
Description:
hypothetical protein LOC565810 [Source:RefSeq peptide;Acc:NP_001170925]
Human Orthologues:
PRKD1, PRKD2, PRKD3
Human Descriptions:
protein kinase D1 [Source:HGNC Symbol;Acc:9407]
protein kinase D2 [Source:HGNC Symbol;Acc:17293]
protein kinase D3 [Source:HGNC Symbol;Acc:9408]
Mouse Orthologues:
Prkd1, Prkd2, Prkd3
Mouse Descriptions:
protein kinase D1 Gene [Source:MGI Symbol;Acc:MGI:99879]
protein kinase D2 Gene [Source:MGI Symbol;Acc:MGI:2141917]
protein kinase D3 Gene [Source:MGI Symbol;Acc:MGI:1922542]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40834 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40834
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038501 Nonsense 423 461 11 11
Genomic Location (Zv9):
Chromosome 7 (position 7801845)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 6750008
GRCz11 7 6908422
GRCz11 7 6983387
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTTCCAGCTGTGGTGTGACCTGCGAGAGTTTGAGCTGCGTATGGGTTA[T/A]CGATATCTCACGCACGAGTCCGACGACAGCCACTGGAGAGCCTACGCTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link