SVEP1

Ensembl ID:
ENSDARG00000013526
Description:
sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1 [Source:HGNC Symbol;Acc:1
Human Orthologue:
SVEP1
Human Description:
sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1 [Source:HGNC Symbol;Acc:1
Mouse Orthologue:
Svep1
Mouse Description:
sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1 Gene [Source:MGI Symbol;A

Alleles

There are 12 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17476 Essential Splice Site Available for shipment Available now
sa9584 Nonsense Available for shipment Available now
sa31569 Nonsense Available for shipment Available now
sa44658 Nonsense Mutation detected in F1 DNA During 2018
sa1285 Essential Splice Site F2 line generated During 2018
sa34058 Nonsense Mutation detected in F1 DNA During 2018
sa20926 Nonsense Available for shipment Available now
sa31570 Nonsense Available for shipment Available now
sa34059 Nonsense Mutation detected in F1 DNA During 2018
sa12993 Nonsense Available for shipment Available now
sa34060 Nonsense Mutation detected in F1 DNA During 2018
sa40882 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa17476
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076882 Essential Splice Site 123 3506 1 48
Genomic Location (Zv9):
Chromosome 7 (position 25419520)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23981272
GRCz11 7 24252429
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACAGAGGAGGTGGCACCTACACCAGGGGGGCTTTCCAGCGAGCAGCGG[T/A]AAGAGCAGCTGTGTAATCACAATGCTTGGGTCTGTGGATGTGAGAAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9584
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076882 Nonsense 343 3506 5 48
Genomic Location (Zv9):
Chromosome 7 (position 25464570)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24026322
GRCz11 7 24297479
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTCTCCCCACCAGAGAATGGCTTCTTCATCCARAATGTGTGCAATAAT[C/T]AGTTTAACTCTGCWTGTGGGGTGCGCTGTCTCCCAGGATTTGACCTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31569
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076882 Nonsense 846 3506 15 48
Genomic Location (Zv9):
Chromosome 7 (position 25487144)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24048896
GRCz11 7 24320053
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGACAGTGGTTTTGCTCCAGAGCACCAACTACAGAAAGATGCTTCATCA[C/T]AGCATGGCTCTCACATGAGGACCAAACGCCATCGGAAAATCACTGGCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44658
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076882 Nonsense 1345 3506 25 48
Genomic Location (Zv9):
Chromosome 7 (position 25496072)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24057824
GRCz11 7 24328981
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGGGAGACTGTGCCAGGTGGACGTAGATGATTGCGAATTGAATTTGTG[T/A]TTGAATGGCGCGACCTGTGTGGATGGAGTGGCCACTTTCACCTGCCGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1285
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076882 Essential Splice Site 2169 3506 37 48
Genomic Location (Zv9):
Chromosome 7 (position 25504837)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24066589
GRCz11 7 24337746
KASP Assay ID:
554-1200.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTATTTCCTGTCCCAGCCCACCTCGCTTGGCAAATGGTTTTATACAGG[T/C]AATTCAATGTTTTTTTNTTTTTTTTTTACCAGGGATGCATCAGTACCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34058
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076882 Nonsense 2334 3506 38 48
Genomic Location (Zv9):
Chromosome 7 (position 25506706)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24068458
GRCz11 7 24339615
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGATGTACCCCATCCCAAGAGTGGAATGACTCATTTCCAGTTTGCAAA[C/T]AAGTGTTTTGTGGACCTCCCCCTGAGGTTGCCTTTGGTGACCCATCAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20926
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076882 Nonsense 2413 3506 38 48
Genomic Location (Zv9):
Chromosome 7 (position 25506945)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24068697
GRCz11 7 24339854
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCCTGAGGACATACCTAATGGAATTGTGGATGTTCAAGGATTAATGTA[T/A]CTTAGTACTGCCGTCTACAGCTGTAAAGCAGGGTATGACATATTAGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31570
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076882 Nonsense 2560 3506 38 48
Genomic Location (Zv9):
Chromosome 7 (position 25507384)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24069136
GRCz11 7 24340293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTTGGAAATAATCACCTCACTTGTGAAGATCATGGCTGGTCAAGCTCT[G/T]AGCCCAAATGTGTTCTTGCTGACTGCGGCCTGCCTCCACATATTGATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34059
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076882 Nonsense 2604 3506 38 48
Genomic Location (Zv9):
Chromosome 7 (position 25507517)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24069269
GRCz11 7 24340426
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAATATGACATGGTTACAAGTCAACAGTTACCAGTAGACAACAGCTTTT[T/A]GCATGGTTCCCTGGTCAAATATCATTGTCATTCTGGATATGAAATAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12993
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076882 Nonsense 2722 3506 38 48
Genomic Location (Zv9):
Chromosome 7 (position 25507870)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24069622
GRCz11 7 24340779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCTGGAGGCATTGCRAATGGTGAAGTGATTGGAAAGTCTTTTCACTTC[A/T]AGGAGCTTATCCACTATGAGTGCCATARTGGGTTTGTCCTTGAGGGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34060
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076882 Nonsense 3233 3506 42 48
Genomic Location (Zv9):
Chromosome 7 (position 25510709)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24072461
GRCz11 7 24343618
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCATAAACAAATATTTAGTGCCAGGTGGATGTGAGAAGATAACAGATT[T/A]ATTGAATGGAAAGGTGCAAGAACACAACCTCTCCAGTGGACGTGCTCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40882
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076882 Nonsense 3255 3506 42 48
Genomic Location (Zv9):
Chromosome 7 (position 25510774)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24072526
GRCz11 7 24343683
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAAGAACACAACCTCTCCAGTGGACGTGCTCTTGAGTTCCACTGTAAT[A/T]AAGGCTACACACTGCAGGGAGAGTCTCTCGTCATGTGTGTGGGAAACGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link