zgc:153650

Ensembl ID:
ENSDARG00000013525
ZFIN ID:
ZDB-GENE-060825-202
Description:
hypothetical protein LOC751731 [Source:RefSeq peptide;Acc:NP_001038906]
Human Orthologue:
TSPAN1
Human Description:
tetraspanin 1 [Source:HGNC Symbol;Acc:20657]
Mouse Orthologue:
Tspan1
Mouse Description:
tetraspanin 1 Gene [Source:MGI Symbol;Acc:MGI:1914055]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25706 Essential Splice Site Mutation detected in F1 DNA During 2018
sa1970 Nonsense F2 line generated During 2018
sa17628 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25706
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011560 Essential Splice Site 10 234 2 8
Genomic Location (Zv9):
Chromosome 1 (position 58033528)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 56798488
GRCz11 1 57525476
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAGGGTTTCCTCAAAGTCATGATGTTTGTCTTCAACGGCATCATCTTC[G/A]TGAGTATAAAATAAAATGTTTACGAGTTCTTTGACAATGAGGACATCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1970
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011560 Nonsense 149 234 6 8
Genomic Location (Zv9):
Chromosome 1 (position 58039248)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 56817078
GRCz11 1 57531168
KASP Assay ID:
554-2552.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAATCAGTGTCATTATATGTSTTTGTTTCTAGCTGAAATGCTGTGGATA[T/G]AACAACTACACTGACTTYAGCGGCTCTAATTTTGTGGAAGAAACATCGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17628
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011560 Nonsense 167 234 6 8
Genomic Location (Zv9):
Chromosome 1 (position 58039302)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 56817132
GRCz11 1 57531222
KASP Assay ID:
2259-1311.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTACACTGACTTYAGCGGCTCWAATTTTGTGGAAGAAACATCGATGTA[T/A]CCTGAAAASTGTTGCTYGAGYGGTTCACMGCGATGTGATGAAAGGGCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link