zbtb34

Ensembl ID:
ENSDARG00000013492
ZFIN ID:
ZDB-GENE-050624-2
Description:
hypothetical protein LOC100004439 [Source:RefSeq peptide;Acc:NP_001116183]
Human Orthologue:
ZBTB34
Human Description:
zinc finger and BTB domain containing 34 [Source:HGNC Symbol;Acc:31446]
Mouse Orthologue:
Zbtb34
Mouse Description:
zinc finger and BTB domain containing 34 Gene [Source:MGI Symbol;Acc:MGI:2685195]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17028 Nonsense Available for shipment Available now
sa31667 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17028
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021558 Nonsense 402 508 1 1
ENSDART00000133300 Nonsense 402 508 2 2
Genomic Location (Zv9):
Chromosome 8 (position 33980868)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 33123594
GRCz11 8 33132826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACACCCTTCGTCTGTAAGTTCTGCGGCAAGAAATAYACTCGCAAAGAT[C/T]AGCTGGARTACCACATCCGTGGCCACACAGACAACAAACCCTTCCATTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31667
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021558 Nonsense 435 508 1 1
ENSDART00000133300 Nonsense 435 508 2 2
Genomic Location (Zv9):
Chromosome 8 (position 33980768)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 33123494
GRCz11 8 33132726
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGATCTGTGGCAAATGTTTTCCCTTCCAAGGCACACTCAACCAGCACT[T/A]GCGCAAGAAGCACATGACCTCTGGCACAGAAATTAACAATCACACCGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link