zgc:123178

Ensembl ID:
ENSDARG00000013489
ZFIN ID:
ZDB-GENE-051120-21
Description:
glioma tumor suppressor candidate region gene 2 protein [Source:RefSeq peptide;Acc:NP_001073415]
Human Orthologue:
GLTSCR2
Human Description:
glioma tumor suppressor candidate region gene 2 [Source:HGNC Symbol;Acc:4333]
Mouse Orthologue:
Gltscr2
Mouse Description:
glioma tumor suppressor candidate region gene 2 Gene [Source:MGI Symbol;Acc:MGI:2154441]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39034 Nonsense Mutation detected in F1 DNA During 2018
sa45528 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39034
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021814 Nonsense 18 457 1 12
ENSDART00000146169   None 180 None 5
Genomic Location (Zv9):
Chromosome 15 (position 6546448)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 6655183
GRCz11 15 6652506
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCGGCCGCCAGGAAGCACAAACGCATGGCAGCGTCTCAACCAGGGTTTT[T/A]ACCTCTTAAATCCGATTTGGATGGTAGTATTTCGAATGCCAAACGGCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45528
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021814 Nonsense 347 457 9 12
ENSDART00000146169 Nonsense 70 180 2 5
Genomic Location (Zv9):
Chromosome 15 (position 6536274)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 6665267
GRCz11 15 6662360
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGGAGTTGCAGAGGAAGGCAGAGCGTGAGGTGATCGATAAGAAACAG[C/T]AGTTGTTCCAATTGCGCTCTATTCGTGCAAACCTGAAGAATCAGGAACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link