skiv2l2

Ensembl ID:
ENSDARG00000013457
ZFIN ID:
ZDB-GENE-040426-2854
Description:
superkiller viralicidic activity 2-like 2 [Source:RefSeq peptide;Acc:NP_999933]
Human Orthologue:
SKIV2L2
Human Description:
superkiller viralicidic activity 2-like 2 (S. cerevisiae) [Source:HGNC Symbol;Acc:18734]
Mouse Orthologue:
Skiv2l2
Mouse Description:
superkiller viralicidic activity 2-like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1919448]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21658 Nonsense Available for shipment Available now
sa21659 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21658
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026244 Nonsense 472 1034 14 27
Genomic Location (Zv9):
Chromosome 10 (position 7253990)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8272236
GRCz11 10 8230936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGTGATTAATGGTTTGATGTATCCTCTCTCTGCCTGTCTCTAGGCCT[T/A]ATTCGCTACAGAAACATTTGCCATGGGGATCAACATGCCTGCGCGAACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21659
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026244 Nonsense 854 1034 22 27
Genomic Location (Zv9):
Chromosome 10 (position 7275011)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8293257
GRCz11 10 8251957
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGCAGATGGATGAGTTGAAGTGCAGAAAGCGTGTGCTGCGCCGACTG[G/T]GATTCGCTACTTCCTCTGATGTCATCGAGATGAAGGGCCGTGTGGCATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link