si:dkey-15f17.9
- Ensembl ID:
- ENSDARG00000013453
- ZFIN ID:
- ZDB-GENE-090313-193
- Description:
- Putative ATP-dependent RNA helicase TDRD9 [Source:UniProtKB/Swiss-Prot;Acc:B8A4F4]
- Human Orthologue:
- TDRD9
- Human Description:
- tudor domain containing 9 [Source:HGNC Symbol;Acc:20122]
- Mouse Orthologue:
- Tdrd9
- Mouse Description:
- tudor domain containing 9 Gene [Source:MGI Symbol;Acc:MGI:1921941]
Alleles
There are 6 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa2676 |
Nonsense |
F2 line generated |
During 2018 |
sa17024 |
Essential Splice Site |
Available for shipment |
Available now |
sa22335 |
Nonsense |
Available for shipment |
Available now |
sa38952 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa35527 |
Splice Site, Nonsense |
Available for shipment |
Available now |
sa4512 |
Nonsense |
F2 line generated |
During 2018 |
Mutation Details
- Allele Name:
- sa2676
- Current Status:
-
F2 line generated
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 13 (position 31628674)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
31274622 |
GRCz11 |
13 |
31405072 |
- KASP Assay ID:
- 554-2480.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AACCTTTGATTTATAGGTCCAGGAACAAGCCCTCCTTCACTGGCCAGTTA[T/A]GAGTATCCAATTCTACCAATTACTAAGAACAGACAAGAGGTACTGTACAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17024
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000019202 |
Essential Splice Site |
171 |
1342 |
4 |
35 |
ENSDART00000124958 |
Essential Splice Site |
171 |
1344 |
4 |
35 |
- Genomic Location (Zv9):
- Chromosome 13 (position 31629067)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
31275015 |
GRCz11 |
13 |
31405465 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GGTGGCACGTGAGCGCAAATGTACTCTGGGAAGCTTGGTGGGGTATCAGG[T/A]GTGAGATGCATGGCATACAATCTCTTTTCCATAACAGTATGAAAATAATA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22335
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 13 (position 31633014)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
31278962 |
GRCz11 |
13 |
31409412 |
- KASP Assay ID:
- 2260-6604.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTGTGTGTGTGATTTGAATTGCAGCGGTCACCGTTGGCCAGTACCTTGT[T/A]GAAGGTAAAGTTGTTGGATATGGGGGATCCTCGCTCGGTTCTCTCCACAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38952
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 13 (position 31637594)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
31283542 |
GRCz11 |
13 |
31413992 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCTTTCTCTCTCAGATTCGGAATTTGCCTCCGTTTGCATTCCTGTGCTA[T/A]AAGCAGCTGCAGTCACTGTTTCGTCAATGTGGACAGGTCAAGTCAATCGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35527
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Splice Site, Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000019202 |
Splice Site, Nonsense |
863 |
1342 |
24 |
35 |
ENSDART00000124958 |
Splice Site, Nonsense |
865 |
1344 |
24 |
35 |
- Genomic Location (Zv9):
- Chromosome 13 (position 31638247)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
31284195 |
GRCz11 |
13 |
31414645 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAATCCCGAGAAACTTCCAACCAGCCGAGATTTCGTCATCAACATTACT[G/T]AGGTGAAAATACTACACATGAAAGTCCTCTCAAATAGGCTTAACCACATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa4512
- Current Status:
-
F2 line generated
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 13 (position 31644902)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
31290850 |
GRCz11 |
13 |
31421300 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GGACCTGCTTTACTGGAGCTCTGTGTGGACTGGGCTGGAACTCTGTTTCC[C/T]AAGAGGCAGTGCTTCCTGAACATGACATTGAGATTGCATTTGACGTCAAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: