
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
hey2
- Ensembl ID:
- ENSDARG00000013441
- ZFIN ID:
- ZDB-GENE-000526-1
- Description:
- Hairy/enhancer-of-split related with YRPW motif protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q9I9L0]
- Human Orthologue:
- HEY2
- Human Description:
- hairy/enhancer-of-split related with YRPW motif 2 [Source:HGNC Symbol;Acc:4881]
- Mouse Orthologue:
- Hey2
- Mouse Description:
- hairy/enhancer-of-split related with YRPW motif 2 Gene [Source:MGI Symbol;Acc:MGI:1341884]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10785 | Essential Splice Site | Available for shipment | Available now |
sa29430 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa16273 | Nonsense | Available for shipment | Available now |
sa23783 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa10785
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000023531 | Essential Splice Site | 110 | 324 | 4 | 5 |
- Genomic Location (Zv9):
- Chromosome 20 (position 39618881)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 39690537 GRCz11 20 39593172 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAGATGACAGTGGATCATCTGAAGATGCTTCAGGCCACAGGAGGAAAAGG[T/C]AGRCCGCATGTTATTGGCTCACCACCTAAWGCTGTAGTGAAATCTGAGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa29430
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000023531 | Nonsense | 136 | 324 | 5 | 5 |
ENSDART00000023531 | Nonsense | 136 | 324 | 5 | 5 |
- Genomic Location (Zv9):
- Chromosome 20 (position 39615842)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 39687498 GRCz11 20 39590133 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GACTTCTTGAGCATCGGCTTCCGGGAGTGTCTGACTGAAGTGGCCAGGTA[T/A]TTGAGCTCTGTGGAAGGCCTGGACTCCAGCGACCCTCTCCGTGTCCGTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16273
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000023531 | Nonsense | 136 | 324 | 5 | 5 |
ENSDART00000023531 | Nonsense | 136 | 324 | 5 | 5 |
- Genomic Location (Zv9):
- Chromosome 20 (position 39615842)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 39687498 GRCz11 20 39590133 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GACTTCTTGAGCATCGGCTTCCGGGAGTGTCTGACTGAAGTGGCCAGGTA[T/G]TTGAGCTCTGTGGAAGGCCTGGACTCCAGCGACCCTCTCCGTGTCCGTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23783
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000023531 | Nonsense | 201 | 324 | 5 | 5 |
- Genomic Location (Zv9):
- Chromosome 20 (position 39615649)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 39687305 GRCz11 20 39589940 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTGGGCTGCCGCTTTGCATCCCATTCCTGCTGCGTTCCTGCAGCAGAGC[G/T]GACTTCCCTCCTCAGAGAGCTCCTCCGGCAGGCTGTCTGAGGCTCCTCAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: