slc8a1a

Ensembl ID:
ENSDARG00000013422
ZFIN ID:
ZDB-GENE-050809-1
Description:
solute carrier family 8 (sodium/calcium exchanger), member 1a [Source:RefSeq peptide;Acc:NP_0010321
Human Orthologue:
SLC8A1
Human Description:
solute carrier family 8 (sodium/calcium exchanger), member 1 [Source:HGNC Symbol;Acc:11068]
Mouse Orthologue:
Slc8a1
Mouse Description:
solute carrier family 8 (sodium/calcium exchanger), member 1 Gene [Source:MGI Symbol;Acc:MGI:107956]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35118 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35118
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046800 Nonsense 149 974 2 11
ENSDART00000089803 Nonsense 149 969 2 10
ENSDART00000103251 Nonsense 149 693 2 8
Genomic Location (Zv9):
Chromosome 11 (position 31476410)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30353772
GRCz11 11 30600956
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTGGAATGAAACGGTCTCAAATCTGACTCTCATGGCTTTGGGTTCTT[C/A]AGCCCCAGAGATTCTGCTGTCCGTGGTTGAAGTGTGTGGGCACAACTTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link