ARHGAP9

Ensembl ID:
ENSDARG00000013390
Description:
Rho GTPase activating protein 9 [Source:HGNC Symbol;Acc:14130]
Human Orthologue:
ARHGAP9
Human Description:
Rho GTPase activating protein 9 [Source:HGNC Symbol;Acc:14130]
Mouse Orthologue:
Arhgap9
Mouse Description:
Rho GTPase activating protein 9 Gene [Source:MGI Symbol;Acc:MGI:2143764]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30881 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30881
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050140 Essential Splice Site 370 509 14 17
Genomic Location (Zv9):
Chromosome 6 (position 58947391)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 59044136
GRCz11 6 59038367
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGGTGTGTGTGTGTGTGTGTGTAACACAGACTTTGTGTGTTTCCTCC[A/T]GAGCGTCTGGATCTAGATGACCCGCAGTGGGAGGATATTCACGTGATCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link