
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:86607
- Ensembl ID:
- ENSDARG00000013382
- ZFIN ID:
- ZDB-GENE-040625-10
- Description:
- Protein CWC15 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6IQU4]
- Human Orthologue:
- CWC15
- Human Description:
- CWC15 spliceosome-associated protein homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:26939]
- Mouse Orthologue:
- Cwc15
- Mouse Description:
- CWC15 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1913320]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11220 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa11220
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027217 | Essential Splice Site | 151 | 244 | 5 | 7 |
- Genomic Location (Zv9):
- Chromosome 5 (position 25248524)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 23075789 GRCz11 5 23579589 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CGAACTGGAGAAGATCAAAAAGGAGCGAGCTGAGGAGCAGGAGAGGAAGG[T/C]GAACCTCATTGATCAWTTACCACCAATAGTTGTCATATCAAGTAATATTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Attention deficit hyperactivity disorder and conduct disorder: Conduct disorder and ADHD: evaluation of conduct problems as a categorical and quantitative trait in the international multicentre ADHD genetics study. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: