zgc:86607

Ensembl ID:
ENSDARG00000013382
ZFIN ID:
ZDB-GENE-040625-10
Description:
Protein CWC15 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6IQU4]
Human Orthologue:
CWC15
Human Description:
CWC15 spliceosome-associated protein homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:26939]
Mouse Orthologue:
Cwc15
Mouse Description:
CWC15 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1913320]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11220 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11220
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027217 Essential Splice Site 151 244 5 7
Genomic Location (Zv9):
Chromosome 5 (position 25248524)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23075789
GRCz11 5 23579589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAACTGGAGAAGATCAAAAAGGAGCGAGCTGAGGAGCAGGAGAGGAAGG[T/C]GAACCTCATTGATCAWTTACCACCAATAGTTGTCATATCAAGTAATATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link