slc2a3

Ensembl ID:
ENSDARG00000013295
ZFIN ID:
ZDB-GENE-040718-390
Description:
solute carrier family 2, facilitated glucose transporter member 3 [Source:RefSeq peptide;Acc:NP_001
Human Orthologues:
SLC2A14, SLC2A3
Human Descriptions:
solute carrier family 2 (facilitated glucose transporter), member 14 [Source:HGNC Symbol;Acc:18301]
solute carrier family 2 (facilitated glucose transporter), member 3 [Source:HGNC Symbol;Acc:11007]
Mouse Orthologue:
Slc2a3
Mouse Description:
solute carrier family 2 (facilitated glucose transporter), member 3 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32235 Essential Splice Site Available for shipment Available now
sa43231 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32235
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016197 Essential Splice Site 39 541 3 10
ENSDART00000131151 Essential Splice Site 38 540 3 10
ENSDART00000134816 Essential Splice Site 39 541 4 11
Genomic Location (Zv9):
Chromosome 19 (position 10323496)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9782035
GRCz11 19 9700960
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGTAAACTAATTAAAAGTATGAGCGTGACCATCAAAAATTAATCTTTC[A/C]GAAACTACGGGCGTTCTTCAATGCCACGTGGATGGAGCGTTACGGGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43231
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016197 Nonsense 65 541 3 10
ENSDART00000131151 Nonsense 64 540 3 10
ENSDART00000134816 Nonsense 65 541 4 11
Genomic Location (Zv9):
Chromosome 19 (position 10323415)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9781954
GRCz11 19 9700879
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGGAGCGTTACGGGGAGCCCATCAGTCCAGGTGTCTGCACCATTGTGT[G/A]GAGTTTTGCCGTGGCCATCTTTAGCGTTGGAGGAATGGCGGGGTCATTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link