zgc:153635

Ensembl ID:
ENSDARG00000013279
ZFIN ID:
ZDB-GENE-061027-379
Description:
zinc finger protein 76 [Source:RefSeq peptide;Acc:NP_001071078]
Human Orthologue:
ZNF76
Human Description:
zinc finger protein 76 (expressed in testis) [Source:HGNC Symbol;Acc:13149]
Mouse Orthologue:
Zfp523
Mouse Description:
zinc finger protein 523 Gene [Source:MGI Symbol;Acc:MGI:2687278]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24047 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24047
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017305 Essential Splice Site 78 516 4 13
Genomic Location (Zv9):
Chromosome 22 (position 701116)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 704269
GRCz11 22 741992
KASP Assay ID:
2261-6187.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTCAGTTGGAGGACGGAACCACCGCCTTCATCCACCACACGCCTAAAG[G/A]TGCCACAGTAAACGATACGACCTCATGAGTGTGTCGAACACATCTGACCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link