zgc:101581

Ensembl ID:
ENSDARG00000013274
ZFIN ID:
ZDB-GENE-041121-14
Description:
eukaryotic translation initiation factor 4E [Source:RefSeq peptide;Acc:NP_001007778]
Human Orthologue:
EIF4E
Human Description:
eukaryotic translation initiation factor 4E [Source:HGNC Symbol;Acc:3287]
Mouse Orthologue:
Eif4e
Mouse Description:
eukaryotic translation initiation factor 4E Gene [Source:MGI Symbol;Acc:MGI:95305]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6289 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6289
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010517 Nonsense 123 216 5 7
Genomic Location (Zv9):
Chromosome 13 (position 12545108)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12543476
GRCz11 13 12675951
KASP Assay ID:
554-4527.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGAGGAGGCCGCTGGCTCATCACTCTCAACAAGCARCAGAGAAAGTA[T/G]GACCTGGACCGCTTTTGGCTGGAAACTGTAAGAGTTTTGAGTTAGTCACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link