zgc:172271

Ensembl ID:
ENSDARG00000013240
ZFIN ID:
ZDB-GENE-080204-110
Description:
hypothetical protein LOC100000381 [Source:RefSeq peptide;Acc:NP_001107938]
Human Orthologues:
LTF, TF
Human Descriptions:
lactotransferrin [Source:HGNC Symbol;Acc:6720]
transferrin [Source:HGNC Symbol;Acc:11740]
Mouse Orthologues:
1300017J02Rik, Ltf, RP24-421P3.2, Trf
Mouse Descriptions:
lactotransferrin Gene [Source:MGI Symbol;Acc:MGI:96837]
RIKEN cDNA 1300017J02 gene Gene [Source:MGI Symbol;Acc:MGI:1919025]
signal recognition particle receptor subunit beta [Source:RefSeq peptide;Acc:NP_033301]
transferrin Gene [Source:MGI Symbol;Acc:MGI:98821]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38574 Nonsense Mutation detected in F1 DNA During 2018
sa14356 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38574
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021969 Nonsense 27 733 2 18
Genomic Location (Zv9):
Chromosome 6 (position 40828981)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40900581
GRCz11 6 40898117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGCAAGCATCTGCCTGTGTATCTACATCCAGGTAAGAAGATGCGCTG[G/A]TGTGCAGTATCAGAGGCAGAGCAGAAGAAGTGTGCAGAACTGGCCAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14356
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021969 Essential Splice Site 596 733 14 18
Genomic Location (Zv9):
Chromosome 6 (position 40818229)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40889829
GRCz11 6 40887365
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGAWGTGGCCTTTATGGAGCACCACAATCTAGAAAGCAACATTGAACG[T/C]AGGATATAATMTCTCTSTCTTTCTTTTTTTGGTAGGTTTAAATATGTTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link